User contributions
From Bioinformatikpedia
(newest | oldest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)
- 23:44, 12 May 2011 (diff | hist) . . (+281) . . Phenylketonuria 2011 (→The PAH gene)
- 23:42, 12 May 2011 (diff | hist) . . (-14) . . Phenylketonuria 2011 (→The PAH gene)
- 23:41, 12 May 2011 (diff | hist) . . (+27) . . Phenylketonuria 2011 (→The PAH gene)
- 23:38, 12 May 2011 (diff | hist) . . (+13) . . Phenylketonuria 2011 (→The PAH gene)
- 23:37, 12 May 2011 (diff | hist) . . (-24) . . Phenylketonuria 2011 (→The PAH gene)
- 23:32, 12 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:31, 12 May 2011 (diff | hist) . . (+10) . . Phenylketonuria 2011 (→The PAH gene)
- 23:30, 12 May 2011 (diff | hist) . . (+14) . . Phenylketonuria 2011 (→The PAH gene)
- 23:28, 12 May 2011 (diff | hist) . . (+12) . . Phenylketonuria 2011 (→The PAH gene)
- 23:28, 12 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→The PAH gene)
- 23:27, 12 May 2011 (diff | hist) . . (+63) . . Phenylketonuria 2011 (→The PAH gene)
- 23:24, 12 May 2011 (diff | hist) . . (+9) . . File:Phenylalanin.png (current)
- 23:23, 12 May 2011 (diff | hist) . . (+117) . . N File:Tyrosin.png (Structure of tyrosine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the public domain.) (current)
- 23:22, 12 May 2011 (diff | hist) . . (+113) . . N File:Phenylalanin.png (Structure of phenylalanine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 23:20, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+6) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+4) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+150) . . Phenylketonuria 2011 (→The PAH gene)
- 23:10, 12 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→The PAH gene)
- 23:09, 12 May 2011 (diff | hist) . . (+3) . . Phenylketonuria 2011 (→The PAH gene)
- 23:07, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:06, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:06, 12 May 2011 (diff | hist) . . (+7) . . Phenylketonuria 2011 (→The PAH gene)
- 23:04, 12 May 2011 (diff | hist) . . (+29) . . Phenylketonuria 2011 (→The PAH gene)
- 23:02, 12 May 2011 (diff | hist) . . (0) . . File:Autorecessive.png (uploaded a new version of "Image:Autorecessive.png") (current)
- 22:59, 12 May 2011 (diff | hist) . . (+149) . . N File:Autorecessive.png (Phenylketonuria is inherited in an autosomal recessive fashion. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 23:05, 11 May 2011 (diff | hist) . . (+126) . . Phenylketonuria 2011
- 22:51, 11 May 2011 (diff | hist) . . (+62) . . Phenylketonuria 2011 (→Summary)
- 22:45, 11 May 2011 (diff | hist) . . (+8) . . Phenylketonuria 2011 (→The PAH gene)
- 18:10, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011 (→The PAH gene)
- 17:21, 11 May 2011 (diff | hist) . . (+51) . . Phenylketonuria 2011 (→The PAH gene)
- 17:20, 11 May 2011 (diff | hist) . . (+901) . . Phenylketonuria 2011 (→The PAH gene)
- 17:06, 11 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 17:05, 11 May 2011 (diff | hist) . . (+419) . . Phenylketonuria 2011 (→The PAH gene)
- 16:49, 11 May 2011 (diff | hist) . . (+1,317) . . Phenylketonuria 2011 (→The PAH gene)
- 16:06, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Mutations)
- 15:39, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011
- 15:39, 11 May 2011 (diff | hist) . . (+69) . . Phenylketonuria 2011 (→still under construction)
- 15:27, 11 May 2011 (diff | hist) . . (+69) . . Phenylalanine hydroxylase reference mRNA (→Reference) (current)
- 15:25, 11 May 2011 (diff | hist) . . (+215) . . Phenylalanine hydroxylase reference mRNA (→Sequence)
- 15:24, 11 May 2011 (diff | hist) . . (+33) . . Phenylalanine hydroxylase reference mRNA
- 15:14, 11 May 2011 (diff | hist) . . (+2,815) . . N Phenylalanine hydroxylase reference mRNA (New page: >gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT GCAGAGAACTCGCTTCCCAG...)
- 15:13, 11 May 2011 (diff | hist) . . (+131) . . Phenylketonuria 2011 (→Reference sequence)
- 15:02, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Reference sequence)
- 15:01, 11 May 2011 (diff | hist) . . (+117) . . Phenylketonuria 2011 (→Mutations)
- 15:01, 11 May 2011 (diff | hist) . . (+912) . . Phenylketonuria 2011 (→Mutations)
- 14:29, 11 May 2011 (diff | hist) . . (+720) . . Phenylketonuria 2011 (→Mutations)
- 13:39, 11 May 2011 (diff | hist) . . (+178) . . Phenylketonuria 2011 (→Mutations)
- 13:17, 11 May 2011 (diff | hist) . . (-6) . . Phenylketonuria 2011 (→Mutations)
- 13:16, 11 May 2011 (diff | hist) . . (+118) . . Phenylketonuria 2011 (→Mutations)