User contributions
From Bioinformatikpedia
(newest | oldest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)
- 17:46, 24 June 2011 (diff | hist) . . (0) . . N File:Polyphen input batch.png (current)
- 17:33, 24 June 2011 (diff | hist) . . (+40) . . Task 6: Sequence-based mutation analysis (→Polyphen2)
- 17:22, 24 June 2011 (diff | hist) . . (+479) . . Task 6: Sequence-based mutation analysis (→SIFT)
- 17:20, 24 June 2011 (diff | hist) . . (0) . . N File:Sift input.png (current)
- 16:24, 24 June 2011 (diff | hist) . . (+3,199) . . Task 6: Sequence-based mutation analysis (→Mutations and secondary structure)
- 16:09, 24 June 2011 (diff | hist) . . (+3,624) . . Task 6: Sequence-based mutation analysis (→PSSM)
- 16:04, 24 June 2011 (diff | hist) . . (+111,638) . . Task 6: Sequence-based mutation analysis (→PSSM)
- 15:40, 24 June 2011 (diff | hist) . . (+2,351) . . Task 6: Sequence-based mutation analysis (→PAM 1/250 matrix)
- 15:28, 24 June 2011 (diff | hist) . . (+2,426) . . Task 6: Sequence-based mutation analysis (→PAM 1/250 matrix)
- 15:06, 24 June 2011 (diff | hist) . . (0) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 15:06, 24 June 2011 (diff | hist) . . (+12) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 15:05, 24 June 2011 (diff | hist) . . (-1) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 15:04, 24 June 2011 (diff | hist) . . (+115) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 15:02, 24 June 2011 (diff | hist) . . (+250) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 14:39, 24 June 2011 (diff | hist) . . (0) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 14:39, 24 June 2011 (diff | hist) . . (+9) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 14:38, 24 June 2011 (diff | hist) . . (+1) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 14:37, 24 June 2011 (diff | hist) . . (+52) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 14:35, 24 June 2011 (diff | hist) . . (+31) . . Task 6: Sequence-based mutation analysis (→BLOSUM 62 matrix)
- 13:52, 24 June 2011 (diff | hist) . . (+18) . . Task 6: Sequence-based mutation analysis
- 13:51, 24 June 2011 (diff | hist) . . (+3) . . Task 6: Sequence-based mutation analysis (→Predicting the effect of mutations with SNAP, SIFT, Polyphen2)
- 13:50, 24 June 2011 (diff | hist) . . (+265) . . Task 6: Sequence-based mutation analysis
- 13:45, 24 June 2011 (diff | hist) . . (+230) . . Task 6: Sequence-based mutation analysis
- 13:38, 24 June 2011 (diff | hist) . . (+368) . . Task 6: Sequence-based mutation analysis
- 13:12, 24 June 2011 (diff | hist) . . (+195) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 11:40, 24 June 2011 (diff | hist) . . (+6) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 11:39, 24 June 2011 (diff | hist) . . (+225) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 18:58, 23 June 2011 (diff | hist) . . (-118) . . Task 6: Sequence-based mutation analysis
- 16:08, 23 June 2011 (diff | hist) . . (+1) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 16:08, 23 June 2011 (diff | hist) . . (+1) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 16:07, 23 June 2011 (diff | hist) . . (-466) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 16:04, 23 June 2011 (diff | hist) . . (0) . . N File:Encrypted img.png (current)
- 15:55, 23 June 2011 (diff | hist) . . (-13) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 15:55, 23 June 2011 (diff | hist) . . (+1,367) . . Task 6: Sequence-based mutation analysis (→Mutation selection)
- 14:36, 23 June 2011 (diff | hist) . . (+26) . . Task 6: Sequence-based mutation analysis
- 14:35, 23 June 2011 (diff | hist) . . (+116) . . N Task 6: Sequence-based mutation analysis (Created page with "== Task description == A detailed task description can be found here.")
- 14:16, 23 June 2011 (diff | hist) . . (+47) . . Phenylketonuria 2011 (→Tasks)
- 11:50, 21 June 2011 (diff | hist) . . (+32) . . Task 5 - Mapping SNPs 2011 (→Introductory talks)
- 11:49, 21 June 2011 (diff | hist) . . (+93) . . N File:Biological Databases.pdf (First part of the presentation from the 21st of June 2011. Outline: * DSSP * HSSP * UniProt) (current)
- 12:29, 19 June 2011 (diff | hist) . . (+1,294) . . Task 5: Mapping point mutations (→dbSNP)
- 11:43, 19 June 2011 (diff | hist) . . (+3) . . Task 5: Mapping point mutations (→dbSNP)
- 11:42, 19 June 2011 (diff | hist) . . (+493) . . Task 5: Mapping point mutations (→dbSNP)
- 10:34, 19 June 2011 (diff | hist) . . (+387) . . Task 5: Mapping point mutations (→Discussion)
- 10:21, 19 June 2011 (diff | hist) . . (+18) . . Task 5: Mapping point mutations (→Processing Data)
- 22:43, 16 June 2011 (diff | hist) . . (0) . . Task 5: Mapping point mutations (→SNPdb)
- 22:43, 16 June 2011 (diff | hist) . . (+429) . . Task 5: Mapping point mutations (→SNPdb)
- 22:20, 16 June 2011 (diff | hist) . . (+6) . . DbSNP Silent Mutations Parser (current)
- 22:18, 16 June 2011 (diff | hist) . . (+16) . . DbSNP Silent Mutations Parser
- 22:14, 16 June 2011 (diff | hist) . . (+15) . . DbSNP Silent Mutations Parser
- 22:10, 16 June 2011 (diff | hist) . . (-15) . . DbSNP Silent Mutations Parser
- 22:10, 16 June 2011 (diff | hist) . . (+3,050) . . N DbSNP Silent Mutations Parser (Created page with "<code> #!/usr/bin/perl if ($#ARGV < 2){ print "wrong arguments!\n"; exit(); } $out_format=$ARGV[0]; $inFile = $ARGV[1]; $mRNA_fasta = $ARGV[2]; if ($out_format ne "list" &…")
- 22:08, 16 June 2011 (diff | hist) . . (+1,328) . . Task 5: Mapping point mutations (→Processing Data)
- 21:46, 16 June 2011 (diff | hist) . . (+1) . . Task 5: Mapping point mutations (→Results)
- 21:46, 16 June 2011 (diff | hist) . . (+633) . . Task 5: Mapping point mutations (→Methodology)
- 20:08, 16 June 2011 (diff | hist) . . (+6) . . Task 5: Mapping point mutations (→Retrieving Data)
- 20:06, 16 June 2011 (diff | hist) . . (+93) . . Task 5: Mapping point mutations (→Methodology)
- 20:02, 16 June 2011 (diff | hist) . . (+935) . . Task 5: Mapping point mutations (→Methodology)
- 19:44, 16 June 2011 (diff | hist) . . (0) . . N File:Silent mutations.png (current)
- 19:25, 16 June 2011 (diff | hist) . . (+224) . . Task 5: Mapping point mutations (→Methodology)
- 19:09, 16 June 2011 (diff | hist) . . (+1,120) . . Task 5: Mapping point mutations (→SNPdb)
- 22:35, 15 June 2011 (diff | hist) . . (0) . . How to search dbSNP (current)
- 22:33, 15 June 2011 (diff | hist) . . (+491) . . N How to search dbSNP (Created page with "To search for silent mutations for your Protein in dbSNP it is useful to filter the results already in the query. This can be done with a simple concatenation of restraints which…")
- 22:28, 15 June 2011 (diff | hist) . . (+33) . . Task 5 - Mapping SNPs 2011 (→Example: Cystic fibrosis)
- 20:02, 14 June 2011 (diff | hist) . . (+678) . . Task 4: Homology based structure predictions (→Qualitative comparison of the best models for each method)
- 19:54, 14 June 2011 (diff | hist) . . (+263) . . Task 4: Homology based structure predictions (→Discussion)
- 19:51, 14 June 2011 (diff | hist) . . (+189) . . Task 4: Homology based structure predictions (→Qualitative comparison of the best models for each method)
- 19:37, 14 June 2011 (diff | hist) . . (+145) . . Task 4: Homology based structure predictions (→Discussion)
- 19:34, 14 June 2011 (diff | hist) . . (0) . . N File:3top.png (current)
- 19:06, 14 June 2011 (diff | hist) . . (+11) . . Task 4: Homology based structure predictions (→Qualitative comparison of the best models for each method)
- 18:01, 14 June 2011 (diff | hist) . . (+1,524) . . Task 4: Homology based structure predictions (→Qualitative comparison of the best models for each method)
- 17:21, 14 June 2011 (diff | hist) . . (+520) . . Task 4: Homology based structure predictions (→Qualitative comparison of the best models for each method)
- 16:53, 14 June 2011 (diff | hist) . . (+375) . . Task 4: Homology based structure predictions (→Qualitative comparison of the best models for each method)
- 16:34, 14 June 2011 (diff | hist) . . (+1,140) . . Task 4: Homology based structure predictions (→Qualitative comparison of the best models for each method)
- 14:51, 14 June 2011 (diff | hist) . . (+2) . . Task 4: Homology based structure predictions (→Swissmodel)
- 14:50, 14 June 2011 (diff | hist) . . (+1,548) . . Task 4: Homology based structure predictions (→Swissmodel)
- 14:44, 14 June 2011 (diff | hist) . . (+67) . . Task 4: Homology based structure predictions (→Discussion)
- 14:27, 14 June 2011 (diff | hist) . . (+1) . . Task 4: Homology based structure predictions (→Values)
- 14:22, 14 June 2011 (diff | hist) . . (+2,675) . . Task 4: Homology based structure predictions (→Swissmodel)
- 13:16, 14 June 2011 (diff | hist) . . (+1,553) . . Task 4: Homology based structure predictions (→Swissmodel)
- 23:02, 13 June 2011 (diff | hist) . . (+9) . . Task 4: Homology based structure predictions (→Description of the quantitative Modeller scores)
- 23:01, 13 June 2011 (diff | hist) . . (+1,229) . . Task 4: Homology based structure predictions (→Numeric evaluation of the calculated models)
- 19:39, 13 June 2011 (diff | hist) . . (-1) . . Task 4: Homology based structure predictions (→Modeller)
- 16:32, 13 June 2011 (diff | hist) . . (+107) . . Task 4: Homology based structure predictions (→Search)
- 20:15, 6 June 2011 (diff | hist) . . (0) . . Task 3: Sequence-based predictions (→BACR_HALSA)
- 22:22, 4 June 2011 (diff | hist) . . (0) . . Task 4: Homology based structure predictions (→Standard workflow)
- 18:10, 3 June 2011 (diff | hist) . . (+14) . . Task 4: Homology based structure predictions (→Standard Workflow)
- 17:34, 3 June 2011 (diff | hist) . . (+7) . . Task 4: Homology based structure predictions (→Standard Workflow)
- 17:27, 3 June 2011 (diff | hist) . . (+7) . . Task 4: Homology based structure predictions (→Standard Workflow)
- 17:14, 3 June 2011 (diff | hist) . . (+7) . . Task 4: Homology based structure predictions (→Standard Workflow)
- 17:00, 3 June 2011 (diff | hist) . . (+997) . . Task 4: Homology based structure predictions (→Swissmodel)
- 13:30, 3 June 2011 (diff | hist) . . (+1,183) . . Task 4: Homology based structure predictions (→Swissmodel)
- 13:30, 3 June 2011 (diff | hist) . . (0) . . N File:1ltz local model quality estimation anolea qmean gromos.png (current)
- 13:29, 3 June 2011 (diff | hist) . . (0) . . N File:1ltz QMEAN plots energy profile plots Batch.1.short.pdb local energy profile QMEANlocal.png (current)
- 13:28, 3 June 2011 (diff | hist) . . (0) . . N File:1ltz residue error pdb plot.jpeg (current)
- 13:27, 3 June 2011 (diff | hist) . . (0) . . N File:1 ltz QMEAN plots Batch.1.short.pdb plot.png slider.png (current)
- 13:27, 3 June 2011 (diff | hist) . . (0) . . N File:1 ltz QMEAN plots Batch.1.short.pdb plot.png density plot.png (current)
- 13:27, 3 June 2011 (diff | hist) . . (0) . . N File:1ltz QMEAN plots Batch.1.short.pdb plot.png (current)
- 13:15, 3 June 2011 (diff | hist) . . (+1,179) . . Task 4: Homology based structure predictions (→Swissmodel)
- 13:13, 3 June 2011 (diff | hist) . . (0) . . N File:1toh local mode quality estimation anolea qmean gromos.png (current)
- 13:13, 3 June 2011 (diff | hist) . . (0) . . N File:1toh QMEAN plots energy profile plots Batch.1.short.pdb local energy profile QMEANlocal.png (current)
- 13:12, 3 June 2011 (diff | hist) . . (0) . . N File:1toh residue error structure.jpeg (current)
- 13:12, 3 June 2011 (diff | hist) . . (0) . . N File:1toh QMEAN plots Batch.1.short.pdb plot.png slider.png (current)
- 13:11, 3 June 2011 (diff | hist) . . (0) . . N File:1toh QMEAN plots Batch.1.short.pdb plot.png density plot.png (current)
- 13:11, 3 June 2011 (diff | hist) . . (0) . . N File:1toh QMEAN plots Batch.1.short.pdb plot.png (current)
- 13:05, 3 June 2011 (diff | hist) . . (+11) . . Task 4: Homology based structure predictions (→Selection of the reference structures)
- 13:04, 3 June 2011 (diff | hist) . . (+476) . . Task 4: Homology based structure predictions (→Numeric evaluation of the calculated models)
- 13:04, 3 June 2011 (diff | hist) . . (0) . . N File:Local quality estimation 1phz template annolea qmean gromos.png (current)
- 12:56, 3 June 2011 (diff | hist) . . (+266) . . Task 4: Homology based structure predictions (→Numeric evaluation of the calculated models)
- 12:56, 3 June 2011 (diff | hist) . . (0) . . N File:QMEAN plots energy profile plots 1phz template.pdb local energy profile QMEANlocal.png (current)
- 12:49, 3 June 2011 (diff | hist) . . (0) . . N File:1phz template coloring by residue error.jpeg (current)
- 12:47, 3 June 2011 (diff | hist) . . (+17) . . Task 4: Homology based structure predictions (→Numeric evaluation of the calculated models)
- 12:45, 3 June 2011 (diff | hist) . . (+414) . . Task 4: Homology based structure predictions (→Numeric evaluation of the calculated models)
- 12:45, 3 June 2011 (diff | hist) . . (0) . . N File:QMEAN plots 1phz template plot.png slider.png (current)
- 12:44, 3 June 2011 (diff | hist) . . (0) . . N File:QMEAN plots 1phz template pdb plot.png density plot.png (current)
- 12:43, 3 June 2011 (diff | hist) . . (0) . . N File:QMEAN plots 1phz template.pdb plot.png (current)
- 12:15, 3 June 2011 (diff | hist) . . (+380) . . Task 4: Homology based structure predictions (→Swissmodel)
- 10:56, 3 June 2011 (diff | hist) . . (+138) . . Task 4: Homology based structure predictions (→Comparison to experimental structure)
- 21:19, 2 June 2011 (diff | hist) . . (+165) . . Task 4: Homology based structure predictions (→Swissmodel)
- 20:34, 2 June 2011 (diff | hist) . . (+11) . . Task 4: Homology based structure predictions (→Swissmodel)
- 20:33, 2 June 2011 (diff | hist) . . (+425) . . Task 4: Homology based structure predictions (→Comparison to experimental structure)
- 20:20, 2 June 2011 (diff | hist) . . (+18) . . Task 4: Homology based structure predictions (→Homology modelling with Swissmodel)
- 20:19, 2 June 2011 (diff | hist) . . (+120) . . Task 4: Homology based structure predictions (→Homology modelling with Swissmodel)
- 20:19, 2 June 2011 (diff | hist) . . (0) . . N File:1ltz A template auto model.png (current)
- 20:18, 2 June 2011 (diff | hist) . . (0) . . N File:1toh A template auto model.png (current)
- 20:18, 2 June 2011 (diff | hist) . . (0) . . N File:1phz A template auto model.png (current)
- 20:14, 2 June 2011 (diff | hist) . . (+745) . . Task 4: Homology based structure predictions (→Homology modelling with Swissmodel)
- 19:30, 2 June 2011 (diff | hist) . . (+163) . . Task 4: Homology based structure predictions (→Overview of available homologous structures)
- 19:25, 2 June 2011 (diff | hist) . . (+168) . . Task 4: Homology based structure predictions (→Overview of available homologous structures)
- 17:23, 2 June 2011 (diff | hist) . . (+30) . . Task 4: Homology based structure predictions (→Calculation of models)
- 17:22, 2 June 2011 (diff | hist) . . (+1,087) . . Task 4: Homology based structure predictions (→Calculation of models)
- 16:44, 2 June 2011 (diff | hist) . . (+313) . . Task 4: Homology based structure predictions (→Overview of available homologous structures)
- 16:03, 2 June 2011 (diff | hist) . . (+180) . . Task 4: Homology based structure predictions (→Calculation of models)
- 15:54, 2 June 2011 (diff | hist) . . (+258) . . Task 4: Homology based structure predictions (→Evaluate your models)
- 15:50, 2 June 2011 (diff | hist) . . (+1,778) . . Task 4: Homology based structure predictions (→Evaluate your models)
- 14:56, 2 June 2011 (diff | hist) . . (+58) . . Task 4: Homology based structure predictions
- 14:49, 2 June 2011 (diff | hist) . . (+103) . . N Task 4: Homology based structure predictions (Created page with "== Task description == The full description of this task can be found here.")
- 14:45, 2 June 2011 (diff | hist) . . (+51) . . Phenylketonuria 2011 (→Tasks)
- 18:16, 1 June 2011 (diff | hist) . . (+1,676) . . Task 3: Sequence-based predictions (→Results and discussion)
- 17:57, 1 June 2011 (diff | hist) . . (+78) . . Task 3: Sequence-based predictions (→Execution)
- 17:55, 1 June 2011 (diff | hist) . . (+1,722) . . Task 3: Sequence-based predictions (→Results and discussion)
- 17:35, 1 June 2011 (diff | hist) . . (+112) . . Task 3: Sequence-based predictions (→Execution)
- 17:34, 1 June 2011 (diff | hist) . . (+715) . . Task 3: Sequence-based predictions (→Results and discussion)
- 17:13, 1 June 2011 (diff | hist) . . (+109) . . Task 3: Sequence-based predictions (→Execution)
- 17:12, 1 June 2011 (diff | hist) . . (+960) . . Task 3: Sequence-based predictions (→Results and discussion)
- 17:05, 1 June 2011 (diff | hist) . . (+117) . . Task 3: Sequence-based predictions (→Execution)
- 17:03, 1 June 2011 (diff | hist) . . (+450) . . Task 3: Sequence-based predictions (→Results and discussion)
- 16:59, 1 June 2011 (diff | hist) . . (+541) . . Task 3: Sequence-based predictions (→Results and discussion)
- 16:55, 1 June 2011 (diff | hist) . . (+117) . . Task 3: Sequence-based predictions (→Execution)
- 16:54, 1 June 2011 (diff | hist) . . (+842) . . Task 3: Sequence-based predictions (→Results and discussion)
- 16:43, 1 June 2011 (diff | hist) . . (+117) . . Task 3: Sequence-based predictions (→Execution)
- 16:41, 1 June 2011 (diff | hist) . . (+673) . . Task 3: Sequence-based predictions (→PolyPhobius)
- 16:36, 1 June 2011 (diff | hist) . . (+153) . . Task 3: Sequence-based predictions (→Execution)
- 16:35, 1 June 2011 (diff | hist) . . (+649) . . Task 3: Sequence-based predictions (→Results and discussion)
- 16:22, 1 June 2011 (diff | hist) . . (+149) . . Task 3: Sequence-based predictions (→Execution)
- 16:20, 1 June 2011 (diff | hist) . . (+1,307) . . Task 3: Sequence-based predictions (→TMHMM)
- 21:36, 29 May 2011 (diff | hist) . . (+453) . . Task 3: Sequence-based predictions (→SignalP)
- 21:25, 29 May 2011 (diff | hist) . . (+579) . . Task 3: Sequence-based predictions (→TMHMM)
- 21:13, 29 May 2011 (diff | hist) . . (-1) . . Task 3: Sequence-based predictions (→RET4_HUMAN)
- 21:11, 29 May 2011 (diff | hist) . . (+5) . . Task 3: Sequence-based predictions (→Results and discussion)
- 21:09, 29 May 2011 (diff | hist) . . (+220) . . Task 3: Sequence-based predictions (→TMHMM)
- 21:06, 29 May 2011 (diff | hist) . . (-1) . . Task 3: Sequence-based predictions (→Execution)
- 21:04, 29 May 2011 (diff | hist) . . (+639) . . Task 3: Sequence-based predictions (→SignalP)
- 20:14, 29 May 2011 (diff | hist) . . (+276) . . Task 3: Sequence-based predictions (→TMHMM)
- 19:12, 29 May 2011 (diff | hist) . . (+215) . . Task 3: Sequence-based predictions (→ProtFun 2.2)
- 19:12, 29 May 2011 (diff | hist) . . (0) . . N File:Protfun ret4 human out.png (current)
- 19:11, 29 May 2011 (diff | hist) . . (0) . . N File:Protfun pah out.png (current)
- 19:11, 29 May 2011 (diff | hist) . . (0) . . N File:Protfun lamp1 human out.png (current)
- 19:10, 29 May 2011 (diff | hist) . . (0) . . N File:Protfun insl5 human out.png (current)
- 19:09, 29 May 2011 (diff | hist) . . (0) . . N File:Protfun bacr halsa out.png (current)
- 19:08, 29 May 2011 (diff | hist) . . (0) . . N File:Protfun a4 human out.png (current)
- 19:07, 29 May 2011 (diff | hist) . . (+236) . . Task 3: Sequence-based predictions (→GOPET)
- 19:06, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet ret4 human out.png (current)
- 19:06, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet pah out.png (current)
- 19:05, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet lamp1 human out.png (current)
- 19:04, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet insl5 human out.png (current)
- 19:04, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet bacr halsa out.png (current)
- 19:03, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet a4 human out.png (current)
- 19:03, 29 May 2011 (diff | hist) . . (-34) . . Task 3: Sequence-based predictions (→Execution)
- 19:02, 29 May 2011 (diff | hist) . . (+2) . . Task 3: Sequence-based predictions (→GOPET)
- 19:01, 29 May 2011 (diff | hist) . . (+55) . . Task 3: Sequence-based predictions (→Pfam)
- 19:01, 29 May 2011 (diff | hist) . . (0) . . N File:Pfam all out.png (current)
- 19:00, 29 May 2011 (diff | hist) . . (0) . . N File:Pfam all in.png (current)
- 18:32, 29 May 2011 (diff | hist) . . (0) . . Task 3: Sequence-based predictions (→Execution)
- 18:32, 29 May 2011 (diff | hist) . . (-6) . . Task 3: Sequence-based predictions (→Execution)
- 18:32, 29 May 2011 (diff | hist) . . (+13) . . Task 3: Sequence-based predictions (→Execution)
- 18:31, 29 May 2011 (diff | hist) . . (+27) . . Task 3: Sequence-based predictions (→Execution)
- 18:30, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet all in.png (current)
- 18:30, 29 May 2011 (diff | hist) . . (+137) . . Task 3: Sequence-based predictions (→Results and discussion)
- 18:29, 29 May 2011 (diff | hist) . . (+137) . . Task 3: Sequence-based predictions (→Results and discussion)
- 18:29, 29 May 2011 (diff | hist) . . (+138) . . Task 3: Sequence-based predictions (→Results and discussion)
- 18:12, 29 May 2011 (diff | hist) . . (+30) . . Task 3: Sequence-based predictions (→ProtFun 2.2)
- 18:11, 29 May 2011 (diff | hist) . . (0) . . N File:Protfun all in.png (current)
- 15:59, 29 May 2011 (diff | hist) . . (+697) . . Task 3: Sequence-based predictions (→Pfam)
- 15:06, 29 May 2011 (diff | hist) . . (+1,592) . . Task 3: Sequence-based predictions (→ProtFun 2.2)
- 14:21, 29 May 2011 (diff | hist) . . (+298) . . Task 3: Sequence-based predictions (→GOPET)
- 14:19, 29 May 2011 (diff | hist) . . (-1) . . Task 3: Sequence-based predictions (→Description)
- 14:18, 29 May 2011 (diff | hist) . . (+1,255) . . Task 3: Sequence-based predictions (→GOPET)
- 14:18, 29 May 2011 (diff | hist) . . (0) . . N File:Gopet flow.png (current)
- 12:32, 29 May 2011 (diff | hist) . . (+14) . . Task 3: Sequence-based predictions (→INSL5_HUMAN)
- 12:31, 29 May 2011 (diff | hist) . . (+8,637) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 12:28, 29 May 2011 (diff | hist) . . (+574) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:46, 29 May 2011 (diff | hist) . . (-1) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:32, 29 May 2011 (diff | hist) . . (+609) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:27, 29 May 2011 (diff | hist) . . (+285) . . Task 3: Sequence-based predictions (→Task 3.4: Prediction of GO terms)
- 10:27, 29 May 2011 (diff | hist) . . (+115) . . Task 3: Sequence-based predictions (→SPOCTOPUS)
- 10:26, 29 May 2011 (diff | hist) . . (0) . . N File:Spoctopus a4 human out.png (current)
- 10:23, 29 May 2011 (diff | hist) . . (0) . . N File:Spoctupus bacr halsa out.png (current)
- 10:23, 29 May 2011 (diff | hist) . . (0) . . N File:Spoctopus RET4 HUMAN out.png (current)
- 10:22, 29 May 2011 (diff | hist) . . (+112) . . Task 3: Sequence-based predictions (→SPOCTOPUS)
- 10:22, 29 May 2011 (diff | hist) . . (0) . . N File:Spoctopus pah out.png (current)
- 10:21, 29 May 2011 (diff | hist) . . (0) . . N File:Spoctopus LAMP1 HUMAN out.png (current)
- 10:20, 29 May 2011 (diff | hist) . . (0) . . N File:Spoctopus INSL5 human out.png (current)
- 10:19, 29 May 2011 (diff | hist) . . (+215) . . Task 3: Sequence-based predictions (→OCTOPUS)
- 10:18, 29 May 2011 (diff | hist) . . (0) . . N File:Octopus RET4 HUMAN out.png (current)
- 10:18, 29 May 2011 (diff | hist) . . (0) . . N File:Octopus pah out.png (current)
- 10:17, 29 May 2011 (diff | hist) . . (0) . . N File:Octopus LAMP1 HUMAN out.png (current)
- 10:17, 29 May 2011 (diff | hist) . . (0) . . N File:Octopus INSL5 human out.png (current)
- 10:16, 29 May 2011 (diff | hist) . . (0) . . N File:Octopus bacr halsa out.png (current)
- 10:16, 29 May 2011 (diff | hist) . . (0) . . N File:Octopus a4 human out.png (current)
- 10:13, 29 May 2011 (diff | hist) . . (+137) . . Task 3: Sequence-based predictions (→TMHMM)
- 10:13, 29 May 2011 (diff | hist) . . (+137) . . Task 3: Sequence-based predictions (→Phobius)
- 10:12, 29 May 2011 (diff | hist) . . (+138) . . Task 3: Sequence-based predictions (→PolyPhobius)
- 10:11, 29 May 2011 (diff | hist) . . (+138) . . Task 3: Sequence-based predictions (→SignalP)
- 10:11, 29 May 2011 (diff | hist) . . (+137) . . Task 3: Sequence-based predictions (→Results and discussion)
- 10:10, 29 May 2011 (diff | hist) . . (+137) . . Task 3: Sequence-based predictions (→SPOCTOPUS)
- 10:06, 29 May 2011 (diff | hist) . . (+137) . . Task 3: Sequence-based predictions (→OCTOPUS)
- 10:04, 29 May 2011 (diff | hist) . . (+29) . . Task 3: Sequence-based predictions (→SPOCTOPUS)
- 10:04, 29 May 2011 (diff | hist) . . (+29) . . Task 3: Sequence-based predictions (→OCTOPUS)
- 10:04, 29 May 2011 (diff | hist) . . (0) . . N File:Octopus pah in.png (current)
- 22:38, 28 May 2011 (diff | hist) . . (+67) . . Task 3: Sequence-based predictions (→PolyPhobius)
- 22:37, 28 May 2011 (diff | hist) . . (0) . . N File:Polyphobius all out.png (current)
- 22:35, 28 May 2011 (diff | hist) . . (0) . . N File:Polyphobius all in.png (current)
- 22:34, 28 May 2011 (diff | hist) . . (+62) . . Task 3: Sequence-based predictions (→Phobius)
- 22:34, 28 May 2011 (diff | hist) . . (0) . . N File:Phobious all out.png (current)
- 22:33, 28 May 2011 (diff | hist) . . (0) . . N File:Phobious all in.png (current)
- 21:50, 28 May 2011 (diff | hist) . . (+3) . . Task 3: Sequence-based predictions (→Results and discussion)
- 21:50, 28 May 2011 (diff | hist) . . (+23) . . Task 3: Sequence-based predictions (→Results and discussion)
- 21:49, 28 May 2011 (diff | hist) . . (+24) . . Task 3: Sequence-based predictions (→Execution)
- 21:48, 28 May 2011 (diff | hist) . . (0) . . N File:Targetp out.png (current)
- 21:47, 28 May 2011 (diff | hist) . . (0) . . N File:Targetp in.png (current)
- 18:51, 28 May 2011 (diff | hist) . . (-2) . . Task 3: Sequence-based predictions (→Description)
- 18:50, 28 May 2011 (diff | hist) . . (+1) . . Task 3: Sequence-based predictions (→SignalP)
- 18:50, 28 May 2011 (diff | hist) . . (+985) . . Task 3: Sequence-based predictions (→SignalP)
- 18:21, 28 May 2011 (diff | hist) . . (+1) . . Task 3: Sequence-based predictions (→TargetP)
- 18:20, 28 May 2011 (diff | hist) . . (+52) . . Task 3: Sequence-based predictions (→TargetP)
- 18:20, 28 May 2011 (diff | hist) . . (+437) . . Task 3: Sequence-based predictions (→TargetP)
- 18:17, 28 May 2011 (diff | hist) . . (0) . . N File:Targetp arc.png (current)
- 18:17, 28 May 2011 (diff | hist) . . (+918) . . Task 3: Sequence-based predictions (→TargetP)
- 17:26, 28 May 2011 (diff | hist) . . (+131) . . Task 3: Sequence-based predictions (→SPOCTOPUS)
- 17:25, 28 May 2011 (diff | hist) . . (+318) . . Task 3: Sequence-based predictions (→SPOCTOPUS)
- 17:21, 28 May 2011 (diff | hist) . . (+101) . . Task 3: Sequence-based predictions (→Description)
- 17:17, 28 May 2011 (diff | hist) . . (+286) . . Task 3: Sequence-based predictions (→OCTOPUS)
- 17:11, 28 May 2011 (diff | hist) . . (+320) . . Task 3: Sequence-based predictions (→Description)
- 17:09, 28 May 2011 (diff | hist) . . (+1,270) . . Task 3: Sequence-based predictions (→OCTOPUS)
- 17:09, 28 May 2011 (diff | hist) . . (0) . . N File:Octopus flow.png (current)
- 13:54, 28 May 2011 (diff | hist) . . (+2) . . Task 3: Sequence-based predictions (→Description)
- 13:54, 28 May 2011 (diff | hist) . . (+1,695) . . Task 3: Sequence-based predictions (→PolyPhobius)
- 12:07, 28 May 2011 (diff | hist) . . (-47) . . Task 3: Sequence-based predictions (→Description)
- 12:06, 28 May 2011 (diff | hist) . . (+328) . . Task 3: Sequence-based predictions (→Phobius)
- 12:05, 28 May 2011 (diff | hist) . . (0) . . Task 3: Sequence-based predictions (→Description)
- 12:04, 28 May 2011 (diff | hist) . . (-26) . . Task 3: Sequence-based predictions (→TMHMM)
- 12:04, 28 May 2011 (diff | hist) . . (+4) . . Task 3: Sequence-based predictions (→Description)
- 12:03, 28 May 2011 (diff | hist) . . (-4) . . Task 3: Sequence-based predictions (→TMHMM)
- 12:03, 28 May 2011 (diff | hist) . . (+57) . . Task 3: Sequence-based predictions (→TMHMM)
- 12:01, 28 May 2011 (diff | hist) . . (+288) . . Task 3: Sequence-based predictions (→Description)
- 11:57, 28 May 2011 (diff | hist) . . (+5) . . Task 3: Sequence-based predictions (→Description)
- 11:56, 28 May 2011 (diff | hist) . . (+19) . . Task 3: Sequence-based predictions (→Description)
- 11:56, 28 May 2011 (diff | hist) . . (0) . . N File:Tmhmm arc.png (current)
- 11:56, 28 May 2011 (diff | hist) . . (+26) . . Task 3: Sequence-based predictions (→TMHMM)
- 11:55, 28 May 2011 (diff | hist) . . (0) . . N File:Phobius arc.png (current)
- 11:53, 28 May 2011 (diff | hist) . . (+759) . . Task 3: Sequence-based predictions (→Phobius)
- 11:37, 28 May 2011 (diff | hist) . . (+744) . . Task 3: Sequence-based predictions (→Task 3.4: Prediction of GO terms)
- 11:37, 28 May 2011 (diff | hist) . . (+1,497) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 10:37, 28 May 2011 (diff | hist) . . (-441) . . Task 3: Sequence-based predictions (→Results and discussion)
- 18:50, 27 May 2011 (diff | hist) . . (+1,666) . . Task 3: Sequence-based predictions (→TMHMM)
- 18:20, 27 May 2011 (diff | hist) . . (+2) . . Task 3: Sequence-based predictions (→TMHMM)
- 18:20, 27 May 2011 (diff | hist) . . (+784) . . Task 3: Sequence-based predictions (→TMHMM)
- 11:51, 27 May 2011 (diff | hist) . . (+3) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:50, 27 May 2011 (diff | hist) . . (+778) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:41, 27 May 2011 (diff | hist) . . (+519) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:35, 27 May 2011 (diff | hist) . . (+847) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:23, 27 May 2011 (diff | hist) . . (+150) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:13, 27 May 2011 (diff | hist) . . (+312) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 10:21, 27 May 2011 (diff | hist) . . (+148) . . Task 3: Sequence-based predictions (→Why is the prediction of transmembrane helices and signal peptides grouped together here?)
- 21:53, 25 May 2011 (diff | hist) . . (+321) . . Task 3: Sequence-based predictions (→Why is the prediction of transmembrane helices and signal peptides grouped together here?)
- 21:47, 25 May 2011 (diff | hist) . . (+501) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the nucleus and the export form the nucleus)
- 21:32, 25 May 2011 (diff | hist) . . (+30) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the nucleus)
- 21:31, 25 May 2011 (diff | hist) . . (+500) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the peroxisome)
- 21:20, 25 May 2011 (diff | hist) . . (+228) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the chloroplast)
- 20:47, 25 May 2011 (diff | hist) . . (+668) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the mitochondrion)
- 19:17, 25 May 2011 (diff | hist) . . (+701) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the mitochondrion)
- 18:54, 25 May 2011 (diff | hist) . . (+69) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 16:46, 25 May 2011 (diff | hist) . . (-1) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the endoplasmic reticulum (ER))
- 16:45, 25 May 2011 (diff | hist) . . (+1,831) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 15:56, 25 May 2011 (diff | hist) . . (+1,366) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 14:40, 25 May 2011 (diff | hist) . . (+50) . . Task 3: Sequence-based predictions (→Task 3.4: Prediction of GO terms)
- 14:38, 25 May 2011 (diff | hist) . . (+112) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 14:32, 25 May 2011 (diff | hist) . . (+223) . . Task 3: Sequence-based predictions
- 14:29, 25 May 2011 (diff | hist) . . (+117) . . N Task 3: Sequence-based predictions (Created page with " == Task description == The full description of this task can be found here.")
- 14:23, 25 May 2011 (diff | hist) . . (+41) . . Phenylketonuria 2011 (→Tasks)
- 11:08, 24 May 2011 (diff | hist) . . (+2) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Installation)
- 23:13, 23 May 2011 (diff | hist) . . (+327) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 23:11, 23 May 2011 (diff | hist) . . (+327) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 23:08, 23 May 2011 (diff | hist) . . (+329) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 23:04, 23 May 2011 (diff | hist) . . (+335) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Results and discussion)
- 22:32, 23 May 2011 (diff | hist) . . (+410) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 22:28, 23 May 2011 (diff | hist) . . (+125) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 22:27, 23 May 2011 (diff | hist) . . (+549) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 22:18, 23 May 2011 (diff | hist) . . (+583) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 22:09, 23 May 2011 (diff | hist) . . (+8) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 22:08, 23 May 2011 (diff | hist) . . (+540) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 21:58, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 21:57, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 21:56, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 21:54, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Results and discussion)
- 21:52, 23 May 2011 (diff | hist) . . (+55) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 21:48, 23 May 2011 (diff | hist) . . (+55) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 21:43, 23 May 2011 (diff | hist) . . (+54) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 21:37, 23 May 2011 (diff | hist) . . (+55) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 21:33, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 39-20% sequence identity)
- 21:32, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 39-20% sequence identity)
- 21:32, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 39-20% sequence identity)
- 21:31, 23 May 2011 (diff | hist) . . (+131) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 59-40% sequence identity)
- 21:31, 23 May 2011 (diff | hist) . . (+131) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 59-40% sequence identity)
- 21:31, 23 May 2011 (diff | hist) . . (+131) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 59-40% sequence identity)
- 21:30, 23 May 2011 (diff | hist) . . (+133) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 89-60% sequence identity)
- 21:29, 23 May 2011 (diff | hist) . . (+133) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 89-60% sequence identity)
- 21:28, 23 May 2011 (diff | hist) . . (+133) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 89-60% sequence identity)
- 21:28, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 21:26, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 21:26, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 21:25, 23 May 2011 (diff | hist) . . (+264) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 21:21, 23 May 2011 (diff | hist) . . (+264) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:36, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 tcoffee.png (current)
- 18:36, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 tcoffee.png (current)
- 18:36, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 tcoffee.png (current)
- 18:35, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 tcoffee.png (current)
- 18:34, 23 May 2011 (diff | hist) . . (+72) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 18:32, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 muscle.png (current)
- 18:32, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 muscle.png (current)
- 18:32, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 muscle.png (current)
- 18:31, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 muscle.png (current)
- 18:31, 23 May 2011 (diff | hist) . . (+67) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 18:29, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 clustalw.png (current)
- 18:28, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 clustalw.png (current)
- 18:28, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 clustalw.png (current)
- 18:28, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 clustalw.png (current)
- 18:27, 23 May 2011 (diff | hist) . . (+75) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 18:24, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 cobalt.png (current)
- 18:24, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 cobalt.png (current)
- 18:23, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 cobalt.png (current)
- 18:23, 23 May 2011 (diff | hist) . . (+51) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:21, 23 May 2011 (diff | hist) . . (+31) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:20, 23 May 2011 (diff | hist) . . (0) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:20, 23 May 2011 (diff | hist) . . (0) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Results and discussion)
- 18:19, 23 May 2011 (diff | hist) . . (+13) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:17, 23 May 2011 (diff | hist) . . (+2) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 99-90% sequence identity)
- 18:16, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 cobalt.png (current)
- 18:14, 23 May 2011 (diff | hist) . . (+1,973) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 18:07, 23 May 2011 (diff | hist) . . (+772) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 18:05, 23 May 2011 (diff | hist) . . (+591) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 18:03, 23 May 2011 (diff | hist) . . (+738) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 18:02, 23 May 2011 (diff | hist) . . (-4) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:02, 23 May 2011 (diff | hist) . . (-13) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:02, 23 May 2011 (diff | hist) . . (+18) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:00, 23 May 2011 (diff | hist) . . (+3) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:00, 23 May 2011 (diff | hist) . . (+815) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Creating multiple sequence alignments with Cobalt)
- 17:59, 23 May 2011 (diff | hist) . . (+436) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Creating multiple sequence alignments with Cobalt)
- 17:58, 23 May 2011 (diff | hist) . . (+87) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:56, 23 May 2011 (diff | hist) . . (-16) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:56, 23 May 2011 (diff | hist) . . (+27) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:55, 23 May 2011 (diff | hist) . . (+4) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:54, 23 May 2011 (diff | hist) . . (0) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:54, 23 May 2011 (diff | hist) . . (+577) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 17:53, 23 May 2011 (diff | hist) . . (-1) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 17:53, 23 May 2011 (diff | hist) . . (+180) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:52, 23 May 2011 (diff | hist) . . (+872) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:22, 23 May 2011 (diff | hist) . . (+399) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:18, 23 May 2011 (diff | hist) . . (-70) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:18, 23 May 2011 (diff | hist) . . (+10) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:17, 23 May 2011 (diff | hist) . . (+213) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:14, 23 May 2011 (diff | hist) . . (+1) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:13, 23 May 2011 (diff | hist) . . (+42) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:12, 23 May 2011 (diff | hist) . . (+11) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:11, 23 May 2011 (diff | hist) . . (+12) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:10, 23 May 2011 (diff | hist) . . (+5) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:08, 23 May 2011 (diff | hist) . . (+15) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:07, 23 May 2011 (diff | hist) . . (+1,105) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 08:32, 22 May 2011 (diff | hist) . . (+178) . . N Task 2: Sequence alignments (sequence searches and multiple alignments) (New page: == Task description == The full description of this task can be found here. == Task 2.1: Sequence searches== == Task 2.2: Multiple sequence alignments==)
- 08:29, 22 May 2011 (diff | hist) . . (+2) . . Task 1: Collect information on the individual disease (→Task description) (current)
- 08:29, 22 May 2011 (diff | hist) . . (-71) . . Task 1: Collect information on the individual disease
- 08:28, 22 May 2011 (diff | hist) . . (+113) . . Task 1: Collect information on the individual disease (→Wiki page)
- 08:26, 22 May 2011 (diff | hist) . . (+64) . . Task 1: Collect information on the individual disease
- 08:25, 22 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:23, 22 May 2011 (diff | hist) . . (+6) . . Task 1: Collect information on the individual disease
- 08:23, 22 May 2011 (diff | hist) . . (-6) . . Task 1: Collect information on the individual disease
- 08:22, 22 May 2011 (diff | hist) . . (-3) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:20, 22 May 2011 (diff | hist) . . (+1) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:20, 22 May 2011 (diff | hist) . . (+1) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:19, 22 May 2011 (diff | hist) . . (-6) . . Task 1: Collect information on the individual disease
- 08:18, 22 May 2011 (diff | hist) . . (+7) . . Task 1: Collect information on the individual disease
- 12:47, 21 May 2011 (diff | hist) . . (+6) . . Task 1: Collect information on the individual disease (→Presentation)
- 12:47, 21 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Presentation)
- 12:44, 21 May 2011 (diff | hist) . . (+139) . . Task 1: Collect information on the individual disease (→Presentation)
- 12:41, 21 May 2011 (diff | hist) . . (+96) . . N File:Phenylketonuria presi.pdf (This presentation gives a very short introduction to phenylketonuria and its associated PAH gene) (current)
- 12:35, 21 May 2011 (diff | hist) . . (+66) . . Task 1: Collect information on the individual disease (→Task description)
- 12:34, 21 May 2011 (diff | hist) . . (-2) . . Task 1: Collect information on the individual disease (→Task description)
- 12:34, 21 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Task description)
- 12:34, 21 May 2011 (diff | hist) . . (+5) . . Task 1: Collect information on the individual disease (→Task description)
- 12:32, 21 May 2011 (diff | hist) . . (+11) . . Task 1: Collect information on the individual disease
- 12:30, 21 May 2011 (diff | hist) . . (+116) . . N Task 1: Collect information on the individual disease (New page: =Task 1: Collect information on the individual disease= == Task description == == Presentation == == Wiki page ==)
- 12:28, 21 May 2011 (diff | hist) . . (+62) . . Phenylketonuria 2011 (→Tasks)
- 12:27, 21 May 2011 (diff | hist) . . (+76) . . Phenylketonuria 2011 (→Tasks)
- 12:24, 21 May 2011 (diff | hist) . . (+14) . . Phenylketonuria 2011
- 19:56, 16 May 2011 (diff | hist) . . (-15) . . Phenylketonuria 2011 (→Phenotype)
- 19:52, 16 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 19:49, 16 May 2011 (diff | hist) . . (-13) . . Phenylketonuria 2011 (→Gene therapy)
- 19:48, 16 May 2011 (diff | hist) . . (+116) . . Phenylketonuria 2011 (→Large neutral aminoacids)
- 19:39, 16 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→Large neutral aminoacids)
- 16:43, 15 May 2011 (diff | hist) . . (+468) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:26, 15 May 2011 (diff | hist) . . (+535) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:18, 15 May 2011 (diff | hist) . . (+801) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:42, 15 May 2011 (diff | hist) . . (+907) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:21, 15 May 2011 (diff | hist) . . (+210) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:19, 15 May 2011 (diff | hist) . . (+160) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:12, 15 May 2011 (diff | hist) . . (+45) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 15:11, 15 May 2011 (diff | hist) . . (+189) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 15:09, 15 May 2011 (diff | hist) . . (+579) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 19:48, 13 May 2011 (diff | hist) . . (+150) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 19:43, 13 May 2011 (diff | hist) . . (+201) . . Phenylketonuria 2011 (→Summary)
- 19:35, 13 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→Phenotype)
- 19:34, 13 May 2011 (diff | hist) . . (+434) . . Phenylketonuria 2011 (→Phenotype)
- 19:22, 13 May 2011 (diff | hist) . . (+86) . . Phenylketonuria 2011 (→Phenotype)
- 19:19, 13 May 2011 (diff | hist) . . (-17) . . Phenylketonuria 2011 (→Phenotype)
- 19:19, 13 May 2011 (diff | hist) . . (+406) . . Phenylketonuria 2011
- 11:39, 13 May 2011 (diff | hist) . . (+24) . . Phenylketonuria 2011 (→Mutations)
- 11:37, 13 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→Reference)
- 11:37, 13 May 2011 (diff | hist) . . (+280) . . Phenylketonuria 2011 (→Protein function)
- 11:35, 13 May 2011 (diff | hist) . . (+240) . . N File:Pah hydroxylating system.png (Schematic process of the phenylalanine hydroxylating system. Disclaimer: This file is redistributed from [Nenad Blau, Francjan J van Spronsen, Harvey L Levy . Phenylketonuria. Lancet 2010; 376: 1417–27] . All rights belong to the creator.) (current)
- 11:35, 13 May 2011 (diff | hist) . . (+22) . . Phenylketonuria 2011 (→Protein function)
- 11:31, 13 May 2011 (diff | hist) . . (+483) . . Phenylketonuria 2011 (→Mutations)
- 11:29, 13 May 2011 (diff | hist) . . (+2) . . File:Pah mutations.png (current)
- 11:28, 13 May 2011 (diff | hist) . . (+94) . . File:Pah mutations.png
- 11:26, 13 May 2011 (diff | hist) . . (+339) . . N File:Pah mutations.png (This figure shows disease associated mutations on the phenylalanine hydroxylase protein. Positions of mutations are highlighted by green side chains. The shown domains are catalytic domain (blue), regulatory domain (red), tetramerisation domain (lilac). D)
- 11:19, 13 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→Mutations)
- 11:17, 13 May 2011 (diff | hist) . . (+215) . . Phenylketonuria 2011
- 11:15, 13 May 2011 (diff | hist) . . (+169) . . N File:Mutationmap.jpg (Mutation map of the PAH gene. last updated: August 13th, 2007 Disclaimer: This figure is redistributed from http://www.pahdb.mcgill.ca. All rights belong to the creator.) (current)
- 11:01, 13 May 2011 (diff | hist) . . (+228) . . Phenylketonuria 2011 (→The PAH gene)
- 10:56, 13 May 2011 (diff | hist) . . (+203) . . Phenylketonuria 2011 (→The PAH gene)
- 23:45, 12 May 2011 (diff | hist) . . (-289) . . Phenylketonuria 2011 (→The PAH gene)
- 23:44, 12 May 2011 (diff | hist) . . (+281) . . Phenylketonuria 2011 (→The PAH gene)
- 23:42, 12 May 2011 (diff | hist) . . (-14) . . Phenylketonuria 2011 (→The PAH gene)
- 23:41, 12 May 2011 (diff | hist) . . (+27) . . Phenylketonuria 2011 (→The PAH gene)
- 23:38, 12 May 2011 (diff | hist) . . (+13) . . Phenylketonuria 2011 (→The PAH gene)
- 23:37, 12 May 2011 (diff | hist) . . (-24) . . Phenylketonuria 2011 (→The PAH gene)
- 23:32, 12 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:31, 12 May 2011 (diff | hist) . . (+10) . . Phenylketonuria 2011 (→The PAH gene)
- 23:30, 12 May 2011 (diff | hist) . . (+14) . . Phenylketonuria 2011 (→The PAH gene)
- 23:28, 12 May 2011 (diff | hist) . . (+12) . . Phenylketonuria 2011 (→The PAH gene)
- 23:28, 12 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→The PAH gene)
- 23:27, 12 May 2011 (diff | hist) . . (+63) . . Phenylketonuria 2011 (→The PAH gene)
- 23:24, 12 May 2011 (diff | hist) . . (+9) . . File:Phenylalanin.png (current)
- 23:23, 12 May 2011 (diff | hist) . . (+117) . . N File:Tyrosin.png (Structure of tyrosine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the public domain.) (current)
- 23:22, 12 May 2011 (diff | hist) . . (+113) . . N File:Phenylalanin.png (Structure of phenylalanine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 23:20, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+6) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+4) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+150) . . Phenylketonuria 2011 (→The PAH gene)
- 23:10, 12 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→The PAH gene)
- 23:09, 12 May 2011 (diff | hist) . . (+3) . . Phenylketonuria 2011 (→The PAH gene)
- 23:07, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:06, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:06, 12 May 2011 (diff | hist) . . (+7) . . Phenylketonuria 2011 (→The PAH gene)
- 23:04, 12 May 2011 (diff | hist) . . (+29) . . Phenylketonuria 2011 (→The PAH gene)
- 23:02, 12 May 2011 (diff | hist) . . (0) . . File:Autorecessive.png (uploaded a new version of "Image:Autorecessive.png") (current)
- 22:59, 12 May 2011 (diff | hist) . . (+149) . . N File:Autorecessive.png (Phenylketonuria is inherited in an autosomal recessive fashion. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 23:05, 11 May 2011 (diff | hist) . . (+126) . . Phenylketonuria 2011
- 22:51, 11 May 2011 (diff | hist) . . (+62) . . Phenylketonuria 2011 (→Summary)
- 22:45, 11 May 2011 (diff | hist) . . (+8) . . Phenylketonuria 2011 (→The PAH gene)
- 18:10, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011 (→The PAH gene)
- 17:21, 11 May 2011 (diff | hist) . . (+51) . . Phenylketonuria 2011 (→The PAH gene)
- 17:20, 11 May 2011 (diff | hist) . . (+901) . . Phenylketonuria 2011 (→The PAH gene)
- 17:06, 11 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 17:05, 11 May 2011 (diff | hist) . . (+419) . . Phenylketonuria 2011 (→The PAH gene)
- 16:49, 11 May 2011 (diff | hist) . . (+1,317) . . Phenylketonuria 2011 (→The PAH gene)
- 16:06, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Mutations)
- 15:39, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011
- 15:39, 11 May 2011 (diff | hist) . . (+69) . . Phenylketonuria 2011 (→still under construction)
- 15:27, 11 May 2011 (diff | hist) . . (+69) . . Phenylalanine hydroxylase reference mRNA (→Reference) (current)
- 15:25, 11 May 2011 (diff | hist) . . (+215) . . Phenylalanine hydroxylase reference mRNA (→Sequence)
- 15:24, 11 May 2011 (diff | hist) . . (+33) . . Phenylalanine hydroxylase reference mRNA
- 15:14, 11 May 2011 (diff | hist) . . (+2,815) . . N Phenylalanine hydroxylase reference mRNA (New page: >gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT GCAGAGAACTCGCTTCCCAG...)
- 15:13, 11 May 2011 (diff | hist) . . (+131) . . Phenylketonuria 2011 (→Reference sequence)
- 15:02, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Reference sequence)
- 15:01, 11 May 2011 (diff | hist) . . (+117) . . Phenylketonuria 2011 (→Mutations)
- 15:01, 11 May 2011 (diff | hist) . . (+912) . . Phenylketonuria 2011 (→Mutations)
- 14:29, 11 May 2011 (diff | hist) . . (+720) . . Phenylketonuria 2011 (→Mutations)
- 13:39, 11 May 2011 (diff | hist) . . (+178) . . Phenylketonuria 2011 (→Mutations)
- 13:17, 11 May 2011 (diff | hist) . . (-6) . . Phenylketonuria 2011 (→Mutations)
- 13:16, 11 May 2011 (diff | hist) . . (+118) . . Phenylketonuria 2011 (→Mutations)