User contributions
From Bioinformatikpedia
(newest | oldest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 17:21, 28 May 2011 (diff | hist) . . (+101) . . Task 3: Sequence-based predictions (→Description)
- 17:17, 28 May 2011 (diff | hist) . . (+286) . . Task 3: Sequence-based predictions (→OCTOPUS)
- 17:11, 28 May 2011 (diff | hist) . . (+320) . . Task 3: Sequence-based predictions (→Description)
- 17:09, 28 May 2011 (diff | hist) . . (+1,270) . . Task 3: Sequence-based predictions (→OCTOPUS)
- 17:09, 28 May 2011 (diff | hist) . . (0) . . N File:Octopus flow.png (current)
- 13:54, 28 May 2011 (diff | hist) . . (+2) . . Task 3: Sequence-based predictions (→Description)
- 13:54, 28 May 2011 (diff | hist) . . (+1,695) . . Task 3: Sequence-based predictions (→PolyPhobius)
- 12:07, 28 May 2011 (diff | hist) . . (-47) . . Task 3: Sequence-based predictions (→Description)
- 12:06, 28 May 2011 (diff | hist) . . (+328) . . Task 3: Sequence-based predictions (→Phobius)
- 12:05, 28 May 2011 (diff | hist) . . (0) . . Task 3: Sequence-based predictions (→Description)
- 12:04, 28 May 2011 (diff | hist) . . (-26) . . Task 3: Sequence-based predictions (→TMHMM)
- 12:04, 28 May 2011 (diff | hist) . . (+4) . . Task 3: Sequence-based predictions (→Description)
- 12:03, 28 May 2011 (diff | hist) . . (-4) . . Task 3: Sequence-based predictions (→TMHMM)
- 12:03, 28 May 2011 (diff | hist) . . (+57) . . Task 3: Sequence-based predictions (→TMHMM)
- 12:01, 28 May 2011 (diff | hist) . . (+288) . . Task 3: Sequence-based predictions (→Description)
- 11:57, 28 May 2011 (diff | hist) . . (+5) . . Task 3: Sequence-based predictions (→Description)
- 11:56, 28 May 2011 (diff | hist) . . (+19) . . Task 3: Sequence-based predictions (→Description)
- 11:56, 28 May 2011 (diff | hist) . . (0) . . N File:Tmhmm arc.png (current)
- 11:56, 28 May 2011 (diff | hist) . . (+26) . . Task 3: Sequence-based predictions (→TMHMM)
- 11:55, 28 May 2011 (diff | hist) . . (0) . . N File:Phobius arc.png (current)
- 11:53, 28 May 2011 (diff | hist) . . (+759) . . Task 3: Sequence-based predictions (→Phobius)
- 11:37, 28 May 2011 (diff | hist) . . (+744) . . Task 3: Sequence-based predictions (→Task 3.4: Prediction of GO terms)
- 11:37, 28 May 2011 (diff | hist) . . (+1,497) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 10:37, 28 May 2011 (diff | hist) . . (-441) . . Task 3: Sequence-based predictions (→Results and discussion)
- 18:50, 27 May 2011 (diff | hist) . . (+1,666) . . Task 3: Sequence-based predictions (→TMHMM)
- 18:20, 27 May 2011 (diff | hist) . . (+2) . . Task 3: Sequence-based predictions (→TMHMM)
- 18:20, 27 May 2011 (diff | hist) . . (+784) . . Task 3: Sequence-based predictions (→TMHMM)
- 11:51, 27 May 2011 (diff | hist) . . (+3) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:50, 27 May 2011 (diff | hist) . . (+778) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:41, 27 May 2011 (diff | hist) . . (+519) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:35, 27 May 2011 (diff | hist) . . (+847) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:23, 27 May 2011 (diff | hist) . . (+150) . . Task 3: Sequence-based predictions (→Annotated sequence features)
- 11:13, 27 May 2011 (diff | hist) . . (+312) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 10:21, 27 May 2011 (diff | hist) . . (+148) . . Task 3: Sequence-based predictions (→Why is the prediction of transmembrane helices and signal peptides grouped together here?)
- 21:53, 25 May 2011 (diff | hist) . . (+321) . . Task 3: Sequence-based predictions (→Why is the prediction of transmembrane helices and signal peptides grouped together here?)
- 21:47, 25 May 2011 (diff | hist) . . (+501) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the nucleus and the export form the nucleus)
- 21:32, 25 May 2011 (diff | hist) . . (+30) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the nucleus)
- 21:31, 25 May 2011 (diff | hist) . . (+500) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the peroxisome)
- 21:20, 25 May 2011 (diff | hist) . . (+228) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the chloroplast)
- 20:47, 25 May 2011 (diff | hist) . . (+668) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the mitochondrion)
- 19:17, 25 May 2011 (diff | hist) . . (+701) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the mitochondrion)
- 18:54, 25 May 2011 (diff | hist) . . (+69) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 16:46, 25 May 2011 (diff | hist) . . (-1) . . Task 3: Sequence-based predictions (→Signalpeptides for the import to the endoplasmic reticulum (ER))
- 16:45, 25 May 2011 (diff | hist) . . (+1,831) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 15:56, 25 May 2011 (diff | hist) . . (+1,366) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 14:40, 25 May 2011 (diff | hist) . . (+50) . . Task 3: Sequence-based predictions (→Task 3.4: Prediction of GO terms)
- 14:38, 25 May 2011 (diff | hist) . . (+112) . . Task 3: Sequence-based predictions (→Task 3.3: Prediction of transmembrane alpha-helices and signal peptides)
- 14:32, 25 May 2011 (diff | hist) . . (+223) . . Task 3: Sequence-based predictions
- 14:29, 25 May 2011 (diff | hist) . . (+117) . . N Task 3: Sequence-based predictions (Created page with " == Task description == The full description of this task can be found here.")
- 14:23, 25 May 2011 (diff | hist) . . (+41) . . Phenylketonuria 2011 (→Tasks)
- 11:08, 24 May 2011 (diff | hist) . . (+2) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Installation)
- 23:13, 23 May 2011 (diff | hist) . . (+327) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 23:11, 23 May 2011 (diff | hist) . . (+327) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 23:08, 23 May 2011 (diff | hist) . . (+329) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 23:04, 23 May 2011 (diff | hist) . . (+335) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Results and discussion)
- 22:32, 23 May 2011 (diff | hist) . . (+410) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 22:28, 23 May 2011 (diff | hist) . . (+125) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 22:27, 23 May 2011 (diff | hist) . . (+549) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 22:18, 23 May 2011 (diff | hist) . . (+583) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 22:09, 23 May 2011 (diff | hist) . . (+8) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 22:08, 23 May 2011 (diff | hist) . . (+540) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 21:58, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 21:57, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 21:56, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 21:54, 23 May 2011 (diff | hist) . . (+110) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Results and discussion)
- 21:52, 23 May 2011 (diff | hist) . . (+55) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 21:48, 23 May 2011 (diff | hist) . . (+55) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 21:43, 23 May 2011 (diff | hist) . . (+54) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 21:37, 23 May 2011 (diff | hist) . . (+55) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 21:33, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 39-20% sequence identity)
- 21:32, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 39-20% sequence identity)
- 21:32, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 39-20% sequence identity)
- 21:31, 23 May 2011 (diff | hist) . . (+131) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 59-40% sequence identity)
- 21:31, 23 May 2011 (diff | hist) . . (+131) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 59-40% sequence identity)
- 21:31, 23 May 2011 (diff | hist) . . (+131) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 59-40% sequence identity)
- 21:30, 23 May 2011 (diff | hist) . . (+133) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 89-60% sequence identity)
- 21:29, 23 May 2011 (diff | hist) . . (+133) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 89-60% sequence identity)
- 21:28, 23 May 2011 (diff | hist) . . (+133) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 89-60% sequence identity)
- 21:28, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 21:26, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 21:26, 23 May 2011 (diff | hist) . . (+132) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Gaps)
- 21:25, 23 May 2011 (diff | hist) . . (+264) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 21:21, 23 May 2011 (diff | hist) . . (+264) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:36, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 tcoffee.png (current)
- 18:36, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 tcoffee.png (current)
- 18:36, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 tcoffee.png (current)
- 18:35, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 tcoffee.png (current)
- 18:34, 23 May 2011 (diff | hist) . . (+72) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→T-Coffee)
- 18:32, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 muscle.png (current)
- 18:32, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 muscle.png (current)
- 18:32, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 muscle.png (current)
- 18:31, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 muscle.png (current)
- 18:31, 23 May 2011 (diff | hist) . . (+67) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Muscle)
- 18:29, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 clustalw.png (current)
- 18:28, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 clustalw.png (current)
- 18:28, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 clustalw.png (current)
- 18:28, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 clustalw.png (current)
- 18:27, 23 May 2011 (diff | hist) . . (+75) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→ClustalW)
- 18:24, 23 May 2011 (diff | hist) . . (0) . . N File:39 20 cobalt.png (current)
- 18:24, 23 May 2011 (diff | hist) . . (0) . . N File:59 40 cobalt.png (current)
- 18:23, 23 May 2011 (diff | hist) . . (0) . . N File:89 60 cobalt.png (current)
- 18:23, 23 May 2011 (diff | hist) . . (+51) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:21, 23 May 2011 (diff | hist) . . (+31) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:20, 23 May 2011 (diff | hist) . . (0) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:20, 23 May 2011 (diff | hist) . . (0) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Results and discussion)
- 18:19, 23 May 2011 (diff | hist) . . (+13) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Cobalt)
- 18:17, 23 May 2011 (diff | hist) . . (+2) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→MSA of 99-90% sequence identity)
- 18:16, 23 May 2011 (diff | hist) . . (0) . . N File:99 90 cobalt.png (current)
- 18:14, 23 May 2011 (diff | hist) . . (+1,973) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 18:07, 23 May 2011 (diff | hist) . . (+772) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 18:05, 23 May 2011 (diff | hist) . . (+591) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 18:03, 23 May 2011 (diff | hist) . . (+738) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 18:02, 23 May 2011 (diff | hist) . . (-4) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:02, 23 May 2011 (diff | hist) . . (-13) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:02, 23 May 2011 (diff | hist) . . (+18) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:00, 23 May 2011 (diff | hist) . . (+3) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Execution)
- 18:00, 23 May 2011 (diff | hist) . . (+815) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Creating multiple sequence alignments with Cobalt)
- 17:59, 23 May 2011 (diff | hist) . . (+436) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Creating multiple sequence alignments with Cobalt)
- 17:58, 23 May 2011 (diff | hist) . . (+87) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:56, 23 May 2011 (diff | hist) . . (-16) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:56, 23 May 2011 (diff | hist) . . (+27) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:55, 23 May 2011 (diff | hist) . . (+4) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:54, 23 May 2011 (diff | hist) . . (0) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:54, 23 May 2011 (diff | hist) . . (+577) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 17:53, 23 May 2011 (diff | hist) . . (-1) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 17:53, 23 May 2011 (diff | hist) . . (+180) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 17:52, 23 May 2011 (diff | hist) . . (+872) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:22, 23 May 2011 (diff | hist) . . (+399) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:18, 23 May 2011 (diff | hist) . . (-70) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:18, 23 May 2011 (diff | hist) . . (+10) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:17, 23 May 2011 (diff | hist) . . (+213) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:14, 23 May 2011 (diff | hist) . . (+1) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:13, 23 May 2011 (diff | hist) . . (+42) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:12, 23 May 2011 (diff | hist) . . (+11) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:11, 23 May 2011 (diff | hist) . . (+12) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:10, 23 May 2011 (diff | hist) . . (+5) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:08, 23 May 2011 (diff | hist) . . (+15) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Methodology)
- 16:07, 23 May 2011 (diff | hist) . . (+1,105) . . Task 2: Sequence alignments (sequence searches and multiple alignments) (→Task 2.2: Multiple sequence alignments)
- 08:32, 22 May 2011 (diff | hist) . . (+178) . . N Task 2: Sequence alignments (sequence searches and multiple alignments) (New page: == Task description == The full description of this task can be found here. == Task 2.1: Sequence searches== == Task 2.2: Multiple sequence alignments==)
- 08:29, 22 May 2011 (diff | hist) . . (+2) . . Task 1: Collect information on the individual disease (→Task description) (current)
- 08:29, 22 May 2011 (diff | hist) . . (-71) . . Task 1: Collect information on the individual disease
- 08:28, 22 May 2011 (diff | hist) . . (+113) . . Task 1: Collect information on the individual disease (→Wiki page)
- 08:26, 22 May 2011 (diff | hist) . . (+64) . . Task 1: Collect information on the individual disease
- 08:25, 22 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:23, 22 May 2011 (diff | hist) . . (+6) . . Task 1: Collect information on the individual disease
- 08:23, 22 May 2011 (diff | hist) . . (-6) . . Task 1: Collect information on the individual disease
- 08:22, 22 May 2011 (diff | hist) . . (-3) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:20, 22 May 2011 (diff | hist) . . (+1) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:20, 22 May 2011 (diff | hist) . . (+1) . . Task 1: Collect information on the individual disease (→Presentation)
- 08:19, 22 May 2011 (diff | hist) . . (-6) . . Task 1: Collect information on the individual disease
- 08:18, 22 May 2011 (diff | hist) . . (+7) . . Task 1: Collect information on the individual disease
- 12:47, 21 May 2011 (diff | hist) . . (+6) . . Task 1: Collect information on the individual disease (→Presentation)
- 12:47, 21 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Presentation)
- 12:44, 21 May 2011 (diff | hist) . . (+139) . . Task 1: Collect information on the individual disease (→Presentation)
- 12:41, 21 May 2011 (diff | hist) . . (+96) . . N File:Phenylketonuria presi.pdf (This presentation gives a very short introduction to phenylketonuria and its associated PAH gene) (current)
- 12:35, 21 May 2011 (diff | hist) . . (+66) . . Task 1: Collect information on the individual disease (→Task description)
- 12:34, 21 May 2011 (diff | hist) . . (-2) . . Task 1: Collect information on the individual disease (→Task description)
- 12:34, 21 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Task description)
- 12:34, 21 May 2011 (diff | hist) . . (+5) . . Task 1: Collect information on the individual disease (→Task description)
- 12:32, 21 May 2011 (diff | hist) . . (+11) . . Task 1: Collect information on the individual disease
- 12:30, 21 May 2011 (diff | hist) . . (+116) . . N Task 1: Collect information on the individual disease (New page: =Task 1: Collect information on the individual disease= == Task description == == Presentation == == Wiki page ==)
- 12:28, 21 May 2011 (diff | hist) . . (+62) . . Phenylketonuria 2011 (→Tasks)
- 12:27, 21 May 2011 (diff | hist) . . (+76) . . Phenylketonuria 2011 (→Tasks)
- 12:24, 21 May 2011 (diff | hist) . . (+14) . . Phenylketonuria 2011
- 19:56, 16 May 2011 (diff | hist) . . (-15) . . Phenylketonuria 2011 (→Phenotype)
- 19:52, 16 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 19:49, 16 May 2011 (diff | hist) . . (-13) . . Phenylketonuria 2011 (→Gene therapy)
- 19:48, 16 May 2011 (diff | hist) . . (+116) . . Phenylketonuria 2011 (→Large neutral aminoacids)
- 19:39, 16 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→Large neutral aminoacids)
- 16:43, 15 May 2011 (diff | hist) . . (+468) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:26, 15 May 2011 (diff | hist) . . (+535) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:18, 15 May 2011 (diff | hist) . . (+801) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:42, 15 May 2011 (diff | hist) . . (+907) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:21, 15 May 2011 (diff | hist) . . (+210) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:19, 15 May 2011 (diff | hist) . . (+160) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 15:12, 15 May 2011 (diff | hist) . . (+45) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 15:11, 15 May 2011 (diff | hist) . . (+189) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 15:09, 15 May 2011 (diff | hist) . . (+579) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 19:48, 13 May 2011 (diff | hist) . . (+150) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 19:43, 13 May 2011 (diff | hist) . . (+201) . . Phenylketonuria 2011 (→Summary)
- 19:35, 13 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→Phenotype)
- 19:34, 13 May 2011 (diff | hist) . . (+434) . . Phenylketonuria 2011 (→Phenotype)
- 19:22, 13 May 2011 (diff | hist) . . (+86) . . Phenylketonuria 2011 (→Phenotype)
- 19:19, 13 May 2011 (diff | hist) . . (-17) . . Phenylketonuria 2011 (→Phenotype)
- 19:19, 13 May 2011 (diff | hist) . . (+406) . . Phenylketonuria 2011
- 11:39, 13 May 2011 (diff | hist) . . (+24) . . Phenylketonuria 2011 (→Mutations)
- 11:37, 13 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→Reference)
- 11:37, 13 May 2011 (diff | hist) . . (+280) . . Phenylketonuria 2011 (→Protein function)
- 11:35, 13 May 2011 (diff | hist) . . (+240) . . N File:Pah hydroxylating system.png (Schematic process of the phenylalanine hydroxylating system. Disclaimer: This file is redistributed from [Nenad Blau, Francjan J van Spronsen, Harvey L Levy . Phenylketonuria. Lancet 2010; 376: 1417–27] . All rights belong to the creator.) (current)
- 11:35, 13 May 2011 (diff | hist) . . (+22) . . Phenylketonuria 2011 (→Protein function)
- 11:31, 13 May 2011 (diff | hist) . . (+483) . . Phenylketonuria 2011 (→Mutations)
- 11:29, 13 May 2011 (diff | hist) . . (+2) . . File:Pah mutations.png (current)
- 11:28, 13 May 2011 (diff | hist) . . (+94) . . File:Pah mutations.png
- 11:26, 13 May 2011 (diff | hist) . . (+339) . . N File:Pah mutations.png (This figure shows disease associated mutations on the phenylalanine hydroxylase protein. Positions of mutations are highlighted by green side chains. The shown domains are catalytic domain (blue), regulatory domain (red), tetramerisation domain (lilac). D)
- 11:19, 13 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→Mutations)
- 11:17, 13 May 2011 (diff | hist) . . (+215) . . Phenylketonuria 2011
- 11:15, 13 May 2011 (diff | hist) . . (+169) . . N File:Mutationmap.jpg (Mutation map of the PAH gene. last updated: August 13th, 2007 Disclaimer: This figure is redistributed from http://www.pahdb.mcgill.ca. All rights belong to the creator.) (current)
- 11:01, 13 May 2011 (diff | hist) . . (+228) . . Phenylketonuria 2011 (→The PAH gene)
- 10:56, 13 May 2011 (diff | hist) . . (+203) . . Phenylketonuria 2011 (→The PAH gene)
- 23:45, 12 May 2011 (diff | hist) . . (-289) . . Phenylketonuria 2011 (→The PAH gene)
- 23:44, 12 May 2011 (diff | hist) . . (+281) . . Phenylketonuria 2011 (→The PAH gene)
- 23:42, 12 May 2011 (diff | hist) . . (-14) . . Phenylketonuria 2011 (→The PAH gene)
- 23:41, 12 May 2011 (diff | hist) . . (+27) . . Phenylketonuria 2011 (→The PAH gene)
- 23:38, 12 May 2011 (diff | hist) . . (+13) . . Phenylketonuria 2011 (→The PAH gene)
- 23:37, 12 May 2011 (diff | hist) . . (-24) . . Phenylketonuria 2011 (→The PAH gene)
- 23:32, 12 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:31, 12 May 2011 (diff | hist) . . (+10) . . Phenylketonuria 2011 (→The PAH gene)
- 23:30, 12 May 2011 (diff | hist) . . (+14) . . Phenylketonuria 2011 (→The PAH gene)
- 23:28, 12 May 2011 (diff | hist) . . (+12) . . Phenylketonuria 2011 (→The PAH gene)
- 23:28, 12 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→The PAH gene)
- 23:27, 12 May 2011 (diff | hist) . . (+63) . . Phenylketonuria 2011 (→The PAH gene)
- 23:24, 12 May 2011 (diff | hist) . . (+9) . . File:Phenylalanin.png (current)
- 23:23, 12 May 2011 (diff | hist) . . (+117) . . N File:Tyrosin.png (Structure of tyrosine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the public domain.) (current)
- 23:22, 12 May 2011 (diff | hist) . . (+113) . . N File:Phenylalanin.png (Structure of phenylalanine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 23:20, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+6) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+4) . . Phenylketonuria 2011 (→The PAH gene)
- 23:11, 12 May 2011 (diff | hist) . . (+150) . . Phenylketonuria 2011 (→The PAH gene)
- 23:10, 12 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→The PAH gene)
- 23:09, 12 May 2011 (diff | hist) . . (+3) . . Phenylketonuria 2011 (→The PAH gene)
- 23:07, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:06, 12 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 23:06, 12 May 2011 (diff | hist) . . (+7) . . Phenylketonuria 2011 (→The PAH gene)
- 23:04, 12 May 2011 (diff | hist) . . (+29) . . Phenylketonuria 2011 (→The PAH gene)
- 23:02, 12 May 2011 (diff | hist) . . (0) . . File:Autorecessive.png (uploaded a new version of "Image:Autorecessive.png") (current)
- 22:59, 12 May 2011 (diff | hist) . . (+149) . . N File:Autorecessive.png (Phenylketonuria is inherited in an autosomal recessive fashion. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 23:05, 11 May 2011 (diff | hist) . . (+126) . . Phenylketonuria 2011
- 22:51, 11 May 2011 (diff | hist) . . (+62) . . Phenylketonuria 2011 (→Summary)
- 22:45, 11 May 2011 (diff | hist) . . (+8) . . Phenylketonuria 2011 (→The PAH gene)
- 18:10, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011 (→The PAH gene)
- 17:21, 11 May 2011 (diff | hist) . . (+51) . . Phenylketonuria 2011 (→The PAH gene)
- 17:20, 11 May 2011 (diff | hist) . . (+901) . . Phenylketonuria 2011 (→The PAH gene)
- 17:06, 11 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 17:05, 11 May 2011 (diff | hist) . . (+419) . . Phenylketonuria 2011 (→The PAH gene)
- 16:49, 11 May 2011 (diff | hist) . . (+1,317) . . Phenylketonuria 2011 (→The PAH gene)
- 16:06, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Mutations)
- 15:39, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011
- 15:39, 11 May 2011 (diff | hist) . . (+69) . . Phenylketonuria 2011 (→still under construction)
- 15:27, 11 May 2011 (diff | hist) . . (+69) . . Phenylalanine hydroxylase reference mRNA (→Reference) (current)
- 15:25, 11 May 2011 (diff | hist) . . (+215) . . Phenylalanine hydroxylase reference mRNA (→Sequence)
- 15:24, 11 May 2011 (diff | hist) . . (+33) . . Phenylalanine hydroxylase reference mRNA
- 15:14, 11 May 2011 (diff | hist) . . (+2,815) . . N Phenylalanine hydroxylase reference mRNA (New page: >gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT GCAGAGAACTCGCTTCCCAG...)
- 15:13, 11 May 2011 (diff | hist) . . (+131) . . Phenylketonuria 2011 (→Reference sequence)
- 15:02, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Reference sequence)
- 15:01, 11 May 2011 (diff | hist) . . (+117) . . Phenylketonuria 2011 (→Mutations)
- 15:01, 11 May 2011 (diff | hist) . . (+912) . . Phenylketonuria 2011 (→Mutations)
- 14:29, 11 May 2011 (diff | hist) . . (+720) . . Phenylketonuria 2011 (→Mutations)
- 13:39, 11 May 2011 (diff | hist) . . (+178) . . Phenylketonuria 2011 (→Mutations)
- 13:17, 11 May 2011 (diff | hist) . . (-6) . . Phenylketonuria 2011 (→Mutations)
- 13:16, 11 May 2011 (diff | hist) . . (+118) . . Phenylketonuria 2011 (→Mutations)