User contributions
From Bioinformatikpedia
(newest | oldest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)
- 09:18, 22 May 2011 (diff | hist) . . (+7) . . Task 1: Collect information on the individual disease
- 13:47, 21 May 2011 (diff | hist) . . (+6) . . Task 1: Collect information on the individual disease (→Presentation)
- 13:47, 21 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Presentation)
- 13:44, 21 May 2011 (diff | hist) . . (+139) . . Task 1: Collect information on the individual disease (→Presentation)
- 13:41, 21 May 2011 (diff | hist) . . (+96) . . N File:Phenylketonuria presi.pdf (This presentation gives a very short introduction to phenylketonuria and its associated PAH gene) (current)
- 13:35, 21 May 2011 (diff | hist) . . (+66) . . Task 1: Collect information on the individual disease (→Task description)
- 13:34, 21 May 2011 (diff | hist) . . (-2) . . Task 1: Collect information on the individual disease (→Task description)
- 13:34, 21 May 2011 (diff | hist) . . (0) . . Task 1: Collect information on the individual disease (→Task description)
- 13:34, 21 May 2011 (diff | hist) . . (+5) . . Task 1: Collect information on the individual disease (→Task description)
- 13:32, 21 May 2011 (diff | hist) . . (+11) . . Task 1: Collect information on the individual disease
- 13:30, 21 May 2011 (diff | hist) . . (+116) . . N Task 1: Collect information on the individual disease (New page: =Task 1: Collect information on the individual disease= == Task description == == Presentation == == Wiki page ==)
- 13:28, 21 May 2011 (diff | hist) . . (+62) . . Phenylketonuria 2011 (→Tasks)
- 13:27, 21 May 2011 (diff | hist) . . (+76) . . Phenylketonuria 2011 (→Tasks)
- 13:24, 21 May 2011 (diff | hist) . . (+14) . . Phenylketonuria 2011
- 20:56, 16 May 2011 (diff | hist) . . (-15) . . Phenylketonuria 2011 (→Phenotype)
- 20:52, 16 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 20:49, 16 May 2011 (diff | hist) . . (-13) . . Phenylketonuria 2011 (→Gene therapy)
- 20:48, 16 May 2011 (diff | hist) . . (+116) . . Phenylketonuria 2011 (→Large neutral aminoacids)
- 20:39, 16 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→Large neutral aminoacids)
- 17:43, 15 May 2011 (diff | hist) . . (+468) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 17:26, 15 May 2011 (diff | hist) . . (+535) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 17:18, 15 May 2011 (diff | hist) . . (+801) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:42, 15 May 2011 (diff | hist) . . (+907) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:21, 15 May 2011 (diff | hist) . . (+210) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:19, 15 May 2011 (diff | hist) . . (+160) . . Phenylketonuria 2011 (→Treatment of phenylketonuria)
- 16:12, 15 May 2011 (diff | hist) . . (+45) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 16:11, 15 May 2011 (diff | hist) . . (+189) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 16:09, 15 May 2011 (diff | hist) . . (+579) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 20:48, 13 May 2011 (diff | hist) . . (+150) . . Phenylketonuria 2011 (→Diagnosis of phenylketonuria)
- 20:43, 13 May 2011 (diff | hist) . . (+201) . . Phenylketonuria 2011 (→Summary)
- 20:35, 13 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→Phenotype)
- 20:34, 13 May 2011 (diff | hist) . . (+434) . . Phenylketonuria 2011 (→Phenotype)
- 20:22, 13 May 2011 (diff | hist) . . (+86) . . Phenylketonuria 2011 (→Phenotype)
- 20:19, 13 May 2011 (diff | hist) . . (-17) . . Phenylketonuria 2011 (→Phenotype)
- 20:19, 13 May 2011 (diff | hist) . . (+406) . . Phenylketonuria 2011
- 12:39, 13 May 2011 (diff | hist) . . (+24) . . Phenylketonuria 2011 (→Mutations)
- 12:37, 13 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→Reference)
- 12:37, 13 May 2011 (diff | hist) . . (+280) . . Phenylketonuria 2011 (→Protein function)
- 12:35, 13 May 2011 (diff | hist) . . (+240) . . N File:Pah hydroxylating system.png (Schematic process of the phenylalanine hydroxylating system. Disclaimer: This file is redistributed from [Nenad Blau, Francjan J van Spronsen, Harvey L Levy . Phenylketonuria. Lancet 2010; 376: 1417–27] . All rights belong to the creator.) (current)
- 12:35, 13 May 2011 (diff | hist) . . (+22) . . Phenylketonuria 2011 (→Protein function)
- 12:31, 13 May 2011 (diff | hist) . . (+483) . . Phenylketonuria 2011 (→Mutations)
- 12:29, 13 May 2011 (diff | hist) . . (+2) . . File:Pah mutations.png (current)
- 12:28, 13 May 2011 (diff | hist) . . (+94) . . File:Pah mutations.png
- 12:26, 13 May 2011 (diff | hist) . . (+339) . . N File:Pah mutations.png (This figure shows disease associated mutations on the phenylalanine hydroxylase protein. Positions of mutations are highlighted by green side chains. The shown domains are catalytic domain (blue), regulatory domain (red), tetramerisation domain (lilac). D)
- 12:19, 13 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→Mutations)
- 12:17, 13 May 2011 (diff | hist) . . (+215) . . Phenylketonuria 2011
- 12:15, 13 May 2011 (diff | hist) . . (+169) . . N File:Mutationmap.jpg (Mutation map of the PAH gene. last updated: August 13th, 2007 Disclaimer: This figure is redistributed from http://www.pahdb.mcgill.ca. All rights belong to the creator.) (current)
- 12:01, 13 May 2011 (diff | hist) . . (+228) . . Phenylketonuria 2011 (→The PAH gene)
- 11:56, 13 May 2011 (diff | hist) . . (+203) . . Phenylketonuria 2011 (→The PAH gene)
- 00:45, 13 May 2011 (diff | hist) . . (-289) . . Phenylketonuria 2011 (→The PAH gene)
- 00:44, 13 May 2011 (diff | hist) . . (+281) . . Phenylketonuria 2011 (→The PAH gene)
- 00:42, 13 May 2011 (diff | hist) . . (-14) . . Phenylketonuria 2011 (→The PAH gene)
- 00:41, 13 May 2011 (diff | hist) . . (+27) . . Phenylketonuria 2011 (→The PAH gene)
- 00:38, 13 May 2011 (diff | hist) . . (+13) . . Phenylketonuria 2011 (→The PAH gene)
- 00:37, 13 May 2011 (diff | hist) . . (-24) . . Phenylketonuria 2011 (→The PAH gene)
- 00:32, 13 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 00:31, 13 May 2011 (diff | hist) . . (+10) . . Phenylketonuria 2011 (→The PAH gene)
- 00:30, 13 May 2011 (diff | hist) . . (+14) . . Phenylketonuria 2011 (→The PAH gene)
- 00:28, 13 May 2011 (diff | hist) . . (+12) . . Phenylketonuria 2011 (→The PAH gene)
- 00:28, 13 May 2011 (diff | hist) . . (-2) . . Phenylketonuria 2011 (→The PAH gene)
- 00:27, 13 May 2011 (diff | hist) . . (+63) . . Phenylketonuria 2011 (→The PAH gene)
- 00:24, 13 May 2011 (diff | hist) . . (+9) . . File:Phenylalanin.png (current)
- 00:23, 13 May 2011 (diff | hist) . . (+117) . . N File:Tyrosin.png (Structure of tyrosine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the public domain.) (current)
- 00:22, 13 May 2011 (diff | hist) . . (+113) . . N File:Phenylalanin.png (Structure of phenylalanine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 00:20, 13 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 00:11, 13 May 2011 (diff | hist) . . (+6) . . Phenylketonuria 2011 (→The PAH gene)
- 00:11, 13 May 2011 (diff | hist) . . (+4) . . Phenylketonuria 2011 (→The PAH gene)
- 00:11, 13 May 2011 (diff | hist) . . (+150) . . Phenylketonuria 2011 (→The PAH gene)
- 00:10, 13 May 2011 (diff | hist) . . (0) . . Phenylketonuria 2011 (→The PAH gene)
- 00:09, 13 May 2011 (diff | hist) . . (+3) . . Phenylketonuria 2011 (→The PAH gene)
- 00:07, 13 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 00:06, 13 May 2011 (diff | hist) . . (+1) . . Phenylketonuria 2011 (→The PAH gene)
- 00:06, 13 May 2011 (diff | hist) . . (+7) . . Phenylketonuria 2011 (→The PAH gene)
- 00:04, 13 May 2011 (diff | hist) . . (+29) . . Phenylketonuria 2011 (→The PAH gene)
- 00:02, 13 May 2011 (diff | hist) . . (0) . . File:Autorecessive.png (uploaded a new version of "Image:Autorecessive.png") (current)
- 23:59, 12 May 2011 (diff | hist) . . (+149) . . N File:Autorecessive.png (Phenylketonuria is inherited in an autosomal recessive fashion. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
- 00:05, 12 May 2011 (diff | hist) . . (+126) . . Phenylketonuria 2011
- 23:51, 11 May 2011 (diff | hist) . . (+62) . . Phenylketonuria 2011 (→Summary)
- 23:45, 11 May 2011 (diff | hist) . . (+8) . . Phenylketonuria 2011 (→The PAH gene)
- 19:10, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011 (→The PAH gene)
- 18:21, 11 May 2011 (diff | hist) . . (+51) . . Phenylketonuria 2011 (→The PAH gene)
- 18:20, 11 May 2011 (diff | hist) . . (+901) . . Phenylketonuria 2011 (→The PAH gene)
- 18:06, 11 May 2011 (diff | hist) . . (-1) . . Phenylketonuria 2011 (→The PAH gene)
- 18:05, 11 May 2011 (diff | hist) . . (+419) . . Phenylketonuria 2011 (→The PAH gene)
- 17:49, 11 May 2011 (diff | hist) . . (+1,317) . . Phenylketonuria 2011 (→The PAH gene)
- 17:06, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Mutations)
- 16:39, 11 May 2011 (diff | hist) . . (+2) . . Phenylketonuria 2011
- 16:39, 11 May 2011 (diff | hist) . . (+69) . . Phenylketonuria 2011 (→still under construction)
- 16:27, 11 May 2011 (diff | hist) . . (+69) . . Phenylalanine hydroxylase reference mRNA (→Reference) (current)
- 16:25, 11 May 2011 (diff | hist) . . (+215) . . Phenylalanine hydroxylase reference mRNA (→Sequence)
- 16:24, 11 May 2011 (diff | hist) . . (+33) . . Phenylalanine hydroxylase reference mRNA
- 16:14, 11 May 2011 (diff | hist) . . (+2,815) . . N Phenylalanine hydroxylase reference mRNA (New page: >gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT GCAGAGAACTCGCTTCCCAG...)
- 16:13, 11 May 2011 (diff | hist) . . (+131) . . Phenylketonuria 2011 (→Reference sequence)
- 16:02, 11 May 2011 (diff | hist) . . (+11) . . Phenylketonuria 2011 (→Reference sequence)
- 16:01, 11 May 2011 (diff | hist) . . (+117) . . Phenylketonuria 2011 (→Mutations)
- 16:01, 11 May 2011 (diff | hist) . . (+912) . . Phenylketonuria 2011 (→Mutations)
- 15:29, 11 May 2011 (diff | hist) . . (+720) . . Phenylketonuria 2011 (→Mutations)
- 14:39, 11 May 2011 (diff | hist) . . (+178) . . Phenylketonuria 2011 (→Mutations)
- 14:17, 11 May 2011 (diff | hist) . . (-6) . . Phenylketonuria 2011 (→Mutations)
- 14:16, 11 May 2011 (diff | hist) . . (+118) . . Phenylketonuria 2011 (→Mutations)
