Difference between revisions of "Phenylalanine hydroxylase reference mRNA"

From Bioinformatikpedia
(Reference)
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
 
 
== Sequence ==
 
== Sequence ==
  +
>gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds
 
  +
<code>
CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT
 
  +
>gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds<br/>
GCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACCTGTCTAATCGACGGGGCTTG
 
  +
CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT<br/>
GGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGGCGGGCAGCGAAGTGGTGCCTCCTGCGTCCC
 
  +
GCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACCTGTCTAATCGACGGGGCTTG<br/>
CCACACCCTCCCTCAGCCCCTCCCCTCCGGCCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGC
 
  +
GGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGGCGGGCAGCGAAGTGGTGCCTCCTGCGTCCC<br/>
CCTGGCCTCCTGCGTCAGGACAAGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACAC
 
  +
CCACACCCTCCCTCAGCCCCTCCCCTCCGGCCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGC<br/>
CCTTTGTAACTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACCT
 
  +
CCTGGCCTCCTGCGTCAGGACAAGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACAC<br/>
GCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCACTGCGGTCCTG
 
  +
CCTTTGTAACTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACCT<br/>
GAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAGGAAACAAGCTATATTGAAGACAACTGCA
 
  +
GCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCACTGCGGTCCTG<br/>
ATCAAAATGGTGCCATATCACTGATCTTCTCACTCAAAGAAGAAGTTGGTGCATTGGCCAAAGTATTGCG
 
  +
GAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAGGAAACAAGCTATATTGAAGACAACTGCA<br/>
CTTATTTGAGGAGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAG
 
  +
ATCAAAATGGTGCCATATCACTGATCTTCTCACTCAAAGAAGAAGTTGGTGCATTGGCCAAAGTATTGCG<br/>
TATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGC
 
  +
CTTATTTGAGGAGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAG<br/>
ATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGTGCCCTGGTTCCCAAG
 
  +
TATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGC<br/>
AACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAGCTATGGAGCGGAACTGGATGCTGACCAC
 
  +
ATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGTGCCCTGGTTCCCAAG<br/>
CCTGGTTTTAAAGATCCTGTGTACCGTGCAAGACGGAAGCAGTTTGCTGACATTGCCTACAACTACCGCC
 
  +
AACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAGCTATGGAGCGGAACTGGATGCTGACCAC<br/>
ATGGGCAGCCCATCCCTCGAGTGGAATACATGGAGGAAGAAAAGAAAACATGGGGCACAGTGTTCAAGAC
 
  +
CCTGGTTTTAAAGATCCTGTGTACCGTGCAAGACGGAAGCAGTTTGCTGACATTGCCTACAACTACCGCC<br/>
TCTGAAGTCCTTGTATAAAACCCATGCTTGCTATGAGTACAATCACATTTTTCCACTTCTTGAAAAGTAC
 
  +
ATGGGCAGCCCATCCCTCGAGTGGAATACATGGAGGAAGAAAAGAAAACATGGGGCACAGTGTTCAAGAC<br/>
TGTGGCTTCCATGAAGATAACATTCCCCAGCTGGAAGACGTTTCTCAATTCCTGCAGACTTGCACTGGTT
 
  +
TCTGAAGTCCTTGTATAAAACCCATGCTTGCTATGAGTACAATCACATTTTTCCACTTCTTGAAAAGTAC<br/>
TCCGCCTCCGACCTGTGGCTGGCCTGCTTTCCTCTCGGGATTTCTTGGGTGGCCTGGCCTTCCGAGTCTT
 
  +
TGTGGCTTCCATGAAGATAACATTCCCCAGCTGGAAGACGTTTCTCAATTCCTGCAGACTTGCACTGGTT<br/>
CCACTGCACACAGTACATCAGACATGGATCCAAGCCCATGTATACCCCCGAACCTGACATCTGCCATGAG
 
  +
TCCGCCTCCGACCTGTGGCTGGCCTGCTTTCCTCTCGGGATTTCTTGGGTGGCCTGGCCTTCCGAGTCTT<br/>
CTGTTGGGACATGTGCCCTTGTTTTCAGATCGCAGCTTTGCCCAGTTTTCCCAGGAAATTGGCCTTGCCT
 
  +
CCACTGCACACAGTACATCAGACATGGATCCAAGCCCATGTATACCCCCGAACCTGACATCTGCCATGAG<br/>
CTCTGGGTGCACCTGATGAATACATTGAAAAGCTCGCCACAATTTACTGGTTTACTGTGGAGTTTGGGCT
 
  +
CTGTTGGGACATGTGCCCTTGTTTTCAGATCGCAGCTTTGCCCAGTTTTCCCAGGAAATTGGCCTTGCCT<br/>
CTGCAAACAAGGAGACTCCATAAAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTAC
 
  +
CTCTGGGTGCACCTGATGAATACATTGAAAAGCTCGCCACAATTTACTGGTTTACTGTGGAGTTTGGGCT<br/>
TGCTTATCAGAGAAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCA
 
  +
CTGCAAACAAGGAGACTCCATAAAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTAC<br/>
CGGAGTTCCAGCCCCTGTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGGAACTTTGC
 
  +
TGCTTATCAGAGAAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCA<br/>
TGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATACACCCAAAGGATTGAGGTCTTGGACAAT
 
  +
CGGAGTTCCAGCCCCTGTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGGAACTTTGC<br/>
ACCCAGCAGCTTAAGATTTTGGCTGATTCCATTAACAGTGAAATTGGAATCCTTTGCAGTGCCCTCCAGA
 
  +
TGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATACACCCAAAGGATTGAGGTCTTGGACAAT<br/>
AAATAAAGTAAAGCCATGGACAGAATGTGGTCTGTCAGCTGTGAATCTGTTGATGGAGATCCAACTATTT
 
  +
ACCCAGCAGCTTAAGATTTTGGCTGATTCCATTAACAGTGAAATTGGAATCCTTTGCAGTGCCCTCCAGA<br/>
CTTTCATCAGAAAAAGTCCGAAAAGCAAACCTTAATTTGAAATAACAGCCTTAAATCCTTTACAAGATGG
 
  +
AAATAAAGTAAAGCCATGGACAGAATGTGGTCTGTCAGCTGTGAATCTGTTGATGGAGATCCAACTATTT<br/>
AGAAACAACAAATAAGTCAAAATAATCTGAAATGACAGGATATGAGTACATACTCAAGAGCATAATGGTA
 
  +
CTTTCATCAGAAAAAGTCCGAAAAGCAAACCTTAATTTGAAATAACAGCCTTAAATCCTTTACAAGATGG<br/>
AATCTTTTGGGGTCATCTTTGATTTAGAGATGATAATCCCATACTCTCAATTGAGTTAAATCAGTAATCT
 
  +
AGAAACAACAAATAAGTCAAAATAATCTGAAATGACAGGATATGAGTACATACTCAAGAGCATAATGGTA<br/>
GTCGCATTTCATCAAGATTAATTAAAATTTGGGACCTGCTTCATTCAAGCTTCATATATGCTTTGCAGAG
 
  +
AATCTTTTGGGGTCATCTTTGATTTAGAGATGATAATCCCATACTCTCAATTGAGTTAAATCAGTAATCT<br/>
AACTCATAAAGGAGCATATAAGGCTAAATGTAAAACACAAGACTGTCATTAGAATTGAATTATTGGGCTT
 
  +
GTCGCATTTCATCAAGATTAATTAAAATTTGGGACCTGCTTCATTCAAGCTTCATATATGCTTTGCAGAG<br/>
AATATAAATCGTAACCTATGAAGTTTATTTTCTATTTTAGTTAACTATGATTCCAATTACTACTTTGTTA
 
  +
AACTCATAAAGGAGCATATAAGGCTAAATGTAAAACACAAGACTGTCATTAGAATTGAATTATTGGGCTT<br/>
TTGTACCTAAGTAAATTTTCTTTAGGTCAGAAGCCCATTAAAATAGTTACAAGCATTGAACTTCTTTAGT
 
  +
AATATAAATCGTAACCTATGAAGTTTATTTTCTATTTTAGTTAACTATGATTCCAATTACTACTTTGTTA<br/>
ATTATATTAATATAAAAACATTTTTGTATGTTTTATTGTAATCATAAATACTGCTGTATAAGGTAATAAA
 
  +
TTGTACCTAAGTAAATTTTCTTTAGGTCAGAAGCCCATTAAAATAGTTACAAGCATTGAACTTCTTTAGT<br/>
ACTCTGCACCTAATCCCCATAACTTCCAGTATCATTTTCCAATTAATTATCAAGTCTGTTTTGGGAAACA
 
  +
ATTATATTAATATAAAAACATTTTTGTATGTTTTATTGTAATCATAAATACTGCTGTATAAGGTAATAAA<br/>
CTTTGAGGACATTTATGATGCAGCAGATGTTGACTAAAGGCTTGGTTGGTAGATATTCAGGAAATGTTCA
 
  +
ACTCTGCACCTAATCCCCATAACTTCCAGTATCATTTTCCAATTAATTATCAAGTCTGTTTTGGGAAACA<br/>
CTGAATAAATAAGTAAATACATTATTGAAAAGCAAATCTGTATAAATGTGAAATTTTTATTTGTATTAGT
 
  +
CTTTGAGGACATTTATGATGCAGCAGATGTTGACTAAAGGCTTGGTTGGTAGATATTCAGGAAATGTTCA<br/>
AATAAAACATTAGTAGTTTA
 
  +
CTGAATAAATAAGTAAATACATTATTGAAAAGCAAATCTGTATAAATGTGAAATTTTTATTTGTATTAGT<br/>
  +
AATAAAACATTAGTAGTTTA<br/>
  +
</code>
   
 
== Reference ==
 
== Reference ==
  +
* [http://www.ncbi.nlm.nih.gov/nuccore/2462721?report=fasta GenBank]

Latest revision as of 16:27, 11 May 2011

Sequence

>gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds
CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT
GCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACCTGTCTAATCGACGGGGCTTG
GGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGGCGGGCAGCGAAGTGGTGCCTCCTGCGTCCC
CCACACCCTCCCTCAGCCCCTCCCCTCCGGCCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGC
CCTGGCCTCCTGCGTCAGGACAAGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACAC
CCTTTGTAACTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACCT
GCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCACTGCGGTCCTG
GAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAGGAAACAAGCTATATTGAAGACAACTGCA
ATCAAAATGGTGCCATATCACTGATCTTCTCACTCAAAGAAGAAGTTGGTGCATTGGCCAAAGTATTGCG
CTTATTTGAGGAGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAG
TATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGC
ATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGTGCCCTGGTTCCCAAG
AACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAGCTATGGAGCGGAACTGGATGCTGACCAC
CCTGGTTTTAAAGATCCTGTGTACCGTGCAAGACGGAAGCAGTTTGCTGACATTGCCTACAACTACCGCC
ATGGGCAGCCCATCCCTCGAGTGGAATACATGGAGGAAGAAAAGAAAACATGGGGCACAGTGTTCAAGAC
TCTGAAGTCCTTGTATAAAACCCATGCTTGCTATGAGTACAATCACATTTTTCCACTTCTTGAAAAGTAC
TGTGGCTTCCATGAAGATAACATTCCCCAGCTGGAAGACGTTTCTCAATTCCTGCAGACTTGCACTGGTT
TCCGCCTCCGACCTGTGGCTGGCCTGCTTTCCTCTCGGGATTTCTTGGGTGGCCTGGCCTTCCGAGTCTT
CCACTGCACACAGTACATCAGACATGGATCCAAGCCCATGTATACCCCCGAACCTGACATCTGCCATGAG
CTGTTGGGACATGTGCCCTTGTTTTCAGATCGCAGCTTTGCCCAGTTTTCCCAGGAAATTGGCCTTGCCT
CTCTGGGTGCACCTGATGAATACATTGAAAAGCTCGCCACAATTTACTGGTTTACTGTGGAGTTTGGGCT
CTGCAAACAAGGAGACTCCATAAAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTAC
TGCTTATCAGAGAAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCA
CGGAGTTCCAGCCCCTGTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGGAACTTTGC
TGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATACACCCAAAGGATTGAGGTCTTGGACAAT
ACCCAGCAGCTTAAGATTTTGGCTGATTCCATTAACAGTGAAATTGGAATCCTTTGCAGTGCCCTCCAGA
AAATAAAGTAAAGCCATGGACAGAATGTGGTCTGTCAGCTGTGAATCTGTTGATGGAGATCCAACTATTT
CTTTCATCAGAAAAAGTCCGAAAAGCAAACCTTAATTTGAAATAACAGCCTTAAATCCTTTACAAGATGG
AGAAACAACAAATAAGTCAAAATAATCTGAAATGACAGGATATGAGTACATACTCAAGAGCATAATGGTA
AATCTTTTGGGGTCATCTTTGATTTAGAGATGATAATCCCATACTCTCAATTGAGTTAAATCAGTAATCT
GTCGCATTTCATCAAGATTAATTAAAATTTGGGACCTGCTTCATTCAAGCTTCATATATGCTTTGCAGAG
AACTCATAAAGGAGCATATAAGGCTAAATGTAAAACACAAGACTGTCATTAGAATTGAATTATTGGGCTT
AATATAAATCGTAACCTATGAAGTTTATTTTCTATTTTAGTTAACTATGATTCCAATTACTACTTTGTTA
TTGTACCTAAGTAAATTTTCTTTAGGTCAGAAGCCCATTAAAATAGTTACAAGCATTGAACTTCTTTAGT
ATTATATTAATATAAAAACATTTTTGTATGTTTTATTGTAATCATAAATACTGCTGTATAAGGTAATAAA
ACTCTGCACCTAATCCCCATAACTTCCAGTATCATTTTCCAATTAATTATCAAGTCTGTTTTGGGAAACA
CTTTGAGGACATTTATGATGCAGCAGATGTTGACTAAAGGCTTGGTTGGTAGATATTCAGGAAATGTTCA
CTGAATAAATAAGTAAATACATTATTGAAAAGCAAATCTGTATAAATGTGAAATTTTTATTTGTATTAGT
AATAAAACATTAGTAGTTTA

Reference