CD task5 protocol

From Bioinformatikpedia
Revision as of 20:35, 7 June 2012 by Vorbergs (talk | contribs) (General Information)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

General Information

Location : 17p13.3

Gene symbol: aspa

Gene number: 443

2 splice variants

NCBI Reference Sequence DNA:

  • NM_000049.2 (1435 bp)


>gi|73622272|ref|NM_000049.2| Homo sapiens aspartoacylase (ASPA), transcript variant 1, mRNA
TTGTAACAGAAAATTAAAATATACTCCACTCAAGGGAATTCTGTACTTTGCCCTTTGGGTAAAGTCTCAT
TTACATTTCTAAACCTTTCTTAAGAAAATCGAATTTCCTTTGATCTCTCTTCTGAATTGCAGAAATCAGA
TAAAAACTACTTGGTGAAATGACTTCTTGTCACATTGCTGAAGAACATATACAAAAGGTTGCTATCTTTG
GAGGAACCCATGGGAATGAGCTAACCGGAGTATTTCTGGTTAAGCATTGGCTAGAGAATGGCGCTGAGAT
TCAGAGAACAGGGCTGGAGGTAAAACCATTTATTACTAACCCCAGAGCAGTGAAGAAGTGTACCAGATAT
ATTGACTGTGACCTGAATCGCATTTTTGACCTTGAAAATCTTGGCAAAAAAATGTCAGAAGATTTGCCAT
ATGAAGTGAGAAGGGCTCAAGAAATAAATCATTTATTTGGTCCAAAAGACAGTGAAGATTCCTATGACAT
TATTTTTGACCTTCACAACACCACCTCTAACATGGGGTGCACTCTTATTCTTGAGGATTCCAGGAATAAC
TTTTTAATTCAGATGTTTCATTACATTAAGACTTCTCTGGCTCCACTACCCTGCTACGTTTATCTGATTG
AGCATCCTTCCCTCAAATATGCGACCACTCGTTCCATAGCCAAGTATCCTGTGGGTATAGAAGTTGGTCC
TCAGCCTCAAGGGGTTCTGAGAGCTGATATCTTGGATCAAATGAGAAAAATGATTAAACATGCTCTTGAT
TTTATACATCATTTCAATGAAGGAAAAGAATTTCCTCCCTGCGCCATTGAGGTCTATAAAATTATAGAGA
AAGTTGATTACCCCCGGGATGAAAATGGAGAAATTGCTGCTATCATCCATCCTAATCTGCAGGATCAAGA
CTGGAAACCACTGCATCCTGGGGATCCCATGTTTTTAACTCTTGATGGGAAGACGATCCCACTGGGCGGA
GACTGTACCGTGTACCCCGTGTTTGTGAATGAGGCCGCATATTACGAAAAGAAAGAAGCTTTTGCAAAGA
CAACTAAACTAACGCTCAATGCAAAAAGTATTCGCTGCTGTTTACATTAGAAATCACTTCCAGCTTACAT
CTTACACGGTGTCTTACAAATTCTGCTAGTCTGTAAGCTCCTTAAGAGTAGGGTTGTGCCTTATTCAACT
GCATACATAGCTCCTAGCACAGTGCCTTATTCGGTAGGCATCTAAGCAAATTTCTTAAATTAATTAATAT
ATCTTTAAAGATATCATATTTTATGTATGTAGCTTATTCAAAGAAGTGTTTCCTATTTCTATATAGTTTA
TTATACATGATACTTGGGTAGCTCAACATTCTTAATAAACAGCCTTTGTATTCAGAATATAAAATTGAAA
TAGATATATATAAAGTTAAAAAAAAAAAAAAAAAA
  • NM_001128085.1 (1368 bp)
>gi|189339201|ref|NM_001128085.1| Homo sapiens aspartoacylase (ASPA), transcript variant 2, mRNA
GAAATGCTCTCCTTTTTCCTAATAAAGCTTTCCACAGAAGACAAACTCTGTACACAAAAAACAAGAAATC
AGATAAAAACTACTTGGTGAAATGACTTCTTGTCACATTGCTGAAGAACATATACAAAAGGTTGCTATCT
TTGGAGGAACCCATGGGAATGAGCTAACCGGAGTATTTCTGGTTAAGCATTGGCTAGAGAATGGCGCTGA
GATTCAGAGAACAGGGCTGGAGGTAAAACCATTTATTACTAACCCCAGAGCAGTGAAGAAGTGTACCAGA
TATATTGACTGTGACCTGAATCGCATTTTTGACCTTGAAAATCTTGGCAAAAAAATGTCAGAAGATTTGC
CATATGAAGTGAGAAGGGCTCAAGAAATAAATCATTTATTTGGTCCAAAAGACAGTGAAGATTCCTATGA
CATTATTTTTGACCTTCACAACACCACCTCTAACATGGGGTGCACTCTTATTCTTGAGGATTCCAGGAAT
AACTTTTTAATTCAGATGTTTCATTACATTAAGACTTCTCTGGCTCCACTACCCTGCTACGTTTATCTGA
TTGAGCATCCTTCCCTCAAATATGCGACCACTCGTTCCATAGCCAAGTATCCTGTGGGTATAGAAGTTGG
TCCTCAGCCTCAAGGGGTTCTGAGAGCTGATATCTTGGATCAAATGAGAAAAATGATTAAACATGCTCTT
GATTTTATACATCATTTCAATGAAGGAAAAGAATTTCCTCCCTGCGCCATTGAGGTCTATAAAATTATAG
AGAAAGTTGATTACCCCCGGGATGAAAATGGAGAAATTGCTGCTATCATCCATCCTAATCTGCAGGATCA
AGACTGGAAACCACTGCATCCTGGGGATCCCATGTTTTTAACTCTTGATGGGAAGACGATCCCACTGGGC
GGAGACTGTACCGTGTACCCCGTGTTTGTGAATGAGGCCGCATATTACGAAAAGAAAGAAGCTTTTGCAA
AGACAACTAAACTAACGCTCAATGCAAAAAGTATTCGCTGCTGTTTACATTAGAAATCACTTCCAGCTTA
CATCTTACACGGTGTCTTACAAATTCTGCTAGTCTGTAAGCTCCTTAAGAGTAGGGTTGTGCCTTATTCA
ACTGCATACATAGCTCCTAGCACAGTGCCTTATTCGGTAGGCATCTAAGCAAATTTCTTAAATTAATTAA
TATATCTTTAAAGATATCATATTTTATGTATGTAGCTTATTCAAAGAAGTGTTTCCTATTTCTATATAGT
TTATTATACATGATACTTGGGTAGCTCAACATTCTTAATAAACAGCCTTTGTATTCAGAATATAAAATTG
AAATAGATATATATAAAGTTAAAAAAAAAAAAAAAAAA


NCBI Reference Sequence Protein:

  • NP_000040.1
1   mtschiaeeh iqkvaifggt hgneltgvfl vkhwlengae iqrtglevkp fitnpravkk
61  ctryidcdln rifdlenlgk kmsedlpyev rraqeinhlf gpkdsedsyd iifdlhntts
121 nmgctliled srnnfliqmf hyiktslapl pcyvyliehp slkyattrsi akypvgievg
181 pqpqgvlrad ildqmrkmik haldfihhfn egkefppcai evykiiekvd yprdengeia
241 aiihpnlqdq dwkplhpgdp mfltldgkti plggdctvyp vfvneaayye kkeafakttk
301 ltlnaksirc clh


  • NP_001121557.1
1   mtschiaeeh iqkvaifggt hgneltgvfl vkhwlengae iqrtglevkp fitnpravkk
61  ctryidcdln rifdlenlgk kmsedlpyev rraqeinhlf gpkdsedsyd iifdlhntts
121 nmgctliled srnnfliqmf hyiktslapl pcyvyliehp slkyattrsi akypvgievg
181 pqpqgvlrad ildqmrkmik haldfihhfn egkefppcai evykiiekvd yprdengeia
241 aiihpnlqdq dwkplhpgdp mfltldgkti plggdctvyp vfvneaayye kkeafakttk
301 ltlnaksirc clh