User contributions

From Bioinformatikpedia

For Pfeiffenberger (talk | block log | uploads | logs)

Search for contributions

 Show contributions of new accounts only
 IP address or username:

Namespace:  all (Main) Talk User User talk Bioinformatikpedia Bioinformatikpedia talk File File talk MediaWiki MediaWiki talk Template Template talk Help Help talk Category Category talk   Invert selection  Associated namespace 

Tag filter: 

 Only show edits that are latest revisions Only show edits that are page creations Hide minor edits

From date:

To date:

(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)

• 23:44, 12 May 2011 (diff | hist) . . (+281)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:42, 12 May 2011 (diff | hist) . . (-14)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:41, 12 May 2011 (diff | hist) . . (+27)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:38, 12 May 2011 (diff | hist) . . (+13)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:37, 12 May 2011 (diff | hist) . . (-24)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:32, 12 May 2011 (diff | hist) . . (-1)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:31, 12 May 2011 (diff | hist) . . (+10)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:30, 12 May 2011 (diff | hist) . . (+14)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:28, 12 May 2011 (diff | hist) . . (+12)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:28, 12 May 2011 (diff | hist) . . (-2)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:27, 12 May 2011 (diff | hist) . . (+63)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:24, 12 May 2011 (diff | hist) . . (+9)‎ . . File:Phenylalanin.png ‎ (current)
• 23:23, 12 May 2011 (diff | hist) . . (+117)‎ . . N File:Tyrosin.png ‎ (Structure of tyrosine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the public domain.) (current)
• 23:22, 12 May 2011 (diff | hist) . . (+113)‎ . . N File:Phenylalanin.png ‎ (Structure of phenylalanine. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
• 23:20, 12 May 2011 (diff | hist) . . (+1)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:11, 12 May 2011 (diff | hist) . . (+6)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:11, 12 May 2011 (diff | hist) . . (+4)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:11, 12 May 2011 (diff | hist) . . (+150)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:10, 12 May 2011 (diff | hist) . . (0)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:09, 12 May 2011 (diff | hist) . . (+3)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:07, 12 May 2011 (diff | hist) . . (+1)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:06, 12 May 2011 (diff | hist) . . (+1)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:06, 12 May 2011 (diff | hist) . . (+7)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:04, 12 May 2011 (diff | hist) . . (+29)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 23:02, 12 May 2011 (diff | hist) . . (0)‎ . . File:Autorecessive.png ‎ (uploaded a new version of "Image:Autorecessive.png") (current)
• 22:59, 12 May 2011 (diff | hist) . . (+149)‎ . . N File:Autorecessive.png ‎ (Phenylketonuria is inherited in an autosomal recessive fashion. Disclaimer: This file is redistributed from Wikimedia and copyrighted under the GFDL.)
• 23:05, 11 May 2011 (diff | hist) . . (+126)‎ . . Phenylketonuria 2011 ‎
• 22:51, 11 May 2011 (diff | hist) . . (+62)‎ . . Phenylketonuria 2011 ‎ (→‎Summary)
• 22:45, 11 May 2011 (diff | hist) . . (+8)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 18:10, 11 May 2011 (diff | hist) . . (+2)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 17:21, 11 May 2011 (diff | hist) . . (+51)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 17:20, 11 May 2011 (diff | hist) . . (+901)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 17:06, 11 May 2011 (diff | hist) . . (-1)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 17:05, 11 May 2011 (diff | hist) . . (+419)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 16:49, 11 May 2011 (diff | hist) . . (+1,317)‎ . . Phenylketonuria 2011 ‎ (→‎The PAH gene)
• 16:06, 11 May 2011 (diff | hist) . . (+11)‎ . . Phenylketonuria 2011 ‎ (→‎Mutations)
• 15:39, 11 May 2011 (diff | hist) . . (+2)‎ . . Phenylketonuria 2011 ‎
• 15:39, 11 May 2011 (diff | hist) . . (+69)‎ . . Phenylketonuria 2011 ‎ (→‎still under construction)
• 15:27, 11 May 2011 (diff | hist) . . (+69)‎ . . Phenylalanine hydroxylase reference mRNA ‎ (→‎Reference) (current)
• 15:25, 11 May 2011 (diff | hist) . . (+215)‎ . . Phenylalanine hydroxylase reference mRNA ‎ (→‎Sequence)
• 15:24, 11 May 2011 (diff | hist) . . (+33)‎ . . Phenylalanine hydroxylase reference mRNA ‎
• 15:14, 11 May 2011 (diff | hist) . . (+2,815)‎ . . N Phenylalanine hydroxylase reference mRNA ‎ (New page: >gi|2462721|gb|U49897.1|HSU49897 Homo sapiens phenylalanine hydroxylase (PAH) mRNA, complete cds CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCTTAGTCCAATT GCAGAGAACTCGCTTCCCAG...)
• 15:13, 11 May 2011 (diff | hist) . . (+131)‎ . . Phenylketonuria 2011 ‎ (→‎Reference sequence)
• 15:02, 11 May 2011 (diff | hist) . . (+11)‎ . . Phenylketonuria 2011 ‎ (→‎Reference sequence)
• 15:01, 11 May 2011 (diff | hist) . . (+117)‎ . . Phenylketonuria 2011 ‎ (→‎Mutations)
• 15:01, 11 May 2011 (diff | hist) . . (+912)‎ . . Phenylketonuria 2011 ‎ (→‎Mutations)
• 14:29, 11 May 2011 (diff | hist) . . (+720)‎ . . Phenylketonuria 2011 ‎ (→‎Mutations)
• 13:39, 11 May 2011 (diff | hist) . . (+178)‎ . . Phenylketonuria 2011 ‎ (→‎Mutations)
• 13:17, 11 May 2011 (diff | hist) . . (-6)‎ . . Phenylketonuria 2011 ‎ (→‎Mutations)
• 13:16, 11 May 2011 (diff | hist) . . (+118)‎ . . Phenylketonuria 2011 ‎ (→‎Mutations)

(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)