Difference between revisions of "Mapping SNPs BCKDHA"

From Bioinformatikpedia
(dbSNP)
(dbSNP)
Line 167: Line 167:
 
|1299||420 ||synonymous||C/T || -
 
|1299||420 ||synonymous||C/T || -
 
|}
 
|}
  +
  +
  +
Point mutations can have an influence on the amino acids or not depending on kind of point mutation. There are two different types: synonymous ans non-synonymous mutations. If a point mutation is sysnonymous it means that the change occurs only in the nucleotide sequence but not in the amino acid sequence. This is possible because of the fact that amino acids are encoded by three nucleotides (codon) and some of the amino acids are encoded by more than one possible arrangement of nucleotides.

Revision as of 12:27, 15 June 2011

General

Maple syrup urine disease is an autosomal recessive disorder that affects the amino acid metabolism. The disease is caused by a defect in the branched-chain alpha-keto acid dehydrogenase complex which blocks oxidative decarboxylation. The result is a rising concentration of branched-chain amino acids. MSUD is caused by mutations in the gene coding for the alpha subunit of the branched-chain keto acid dehydrogenase(BCKDHA).

HGMD

Searching for "BCKDHA" a total of 39 mutations are reported, comprised of the following mutation types:

  • missense/nonsense: 33 mutations
  • small deletions: 3 mutations
  • small insertions: 1 mutation
  • gross deletions: 1 mutation
  • complex rearrangements: 1 mutation

For us the missense/nonsense mutations are the most interesting ones, as a single nucleotide change can lead to the phenotype of Maple Syrup Urine Disease.

Codon change Amino Acid change Codon number
gCAG-GAG Gln-Glu 80
ACG-ATG THr-Met 106
cCGG-TGG Arg-Trp 114
gTAT-AAAT Tyr-Asn 121
CGG-CAG Arg-Gln 122
cCAG-AAG Gln-Lys 145
ATC-ACC Ile-Thr 168
GCG-GTG Ala-Val 171
GCG-GTG Ala-Val 175
cGGC-AGC Gly-Ser 204
cGCT-ACT Ala-Thr 208
TGC-TAC Cys-Thr 213
cCGG-TGG Arg-Trp 220
AAT-AGT Asn-Ser 222
GGC-GAC Gly-Asp 238
tGCA-CCA Ala-Pro 240
aCGA-TGA Arg-Term 242
cGGG-AGG Gly-Arg 245
cCGC-TGC Arg-Cys 252
CGC-CAC Arg-His 252
tGGT-AGT Gly-Ser 255
GAT-GCT Asp-Ala 257
ACA-AGA Thr-Arg 265
cCGA-TGA Arg-Term 269
ATC-ACC Ile-Thr 281
cGAG-AAG Glu-Lys 282
gGCC-ACC Ala-Thr 283
CGC-CAC Arg-His 301
cCGG-TGG Arg-Trp 318
TTC-TGC Phe-Cys 364
cGTG-ATG Val-Met 367
TAT-TGT Tyr-Cys 368
cTAC-AAC Tyr-Asn 393


dbSNP

results for the SNPs search with BCKDHA:

-all: 742

-human: 371

SNPs in human

ID mutation in sequence amino acid position
rs137852876 CTTGAGTGCCCCATCATCTTCTTCTG[C/G]CGGAACAATGGCTACGCCATCTCCA Ser pos=251
rs137852875 TGATGTGTTTGCCGTATACAACGCCA[C/G]AAAGGAGGCCCGACGGCGGGCTGTG Ser pos=251
rs137852874 CAGCCAGTGAGGGGGACGCCCATGCC[A/G]GCTTCAACTTCGCTGCCACACTTGA Arg pos=251
rs137852873 TTGAGTGCCCCATCATCTTCTTCTGC[C/T]GGAACAATGGCTACGCCATCTCCAC Tyr pos=251
rs137852872 GCCCAAACCCAACCCCAACCTACTCT[G/T]CTCAGACGTGTATCAGGAGATGCCC Lys pos=251
rs137852871 GTGTCCCCACAGCAGCACGAGGCCCC[A/G]GGTATGGCATCATGTCAATCCGCGT Arg pos=251


results for the gene search with BCKDHA

mRNA pos aa position function mutation aa change
54 5 synonymous C/T -
72 12 synonymous C/A -
125 29 missense G/A Gly/Glu
153 83 synonymous C/G, C/T -
155 39 missense C/A Pro/His
156 39 synonymous C/A -
238 82 missense A/C Met/Leu
330 97 synonymous G/C -
491 151 missense C/T Thr/Met
547 170 missense C/T Pro/Ser
678 213 synonymous C/T -
687 216 synonymous G/T -
769 244 missense G/A Gly/Arg
879 280 synonymous C/T -
1011 324 synonymous C/T -
1012 325 frame shift C/ -
1014 325 synonymous C/T -
1120 361 missense A/G Ile/Val
1260 407 synonymous A/G -
1299 420 synonymous C/T -


Point mutations can have an influence on the amino acids or not depending on kind of point mutation. There are two different types: synonymous ans non-synonymous mutations. If a point mutation is sysnonymous it means that the change occurs only in the nucleotide sequence but not in the amino acid sequence. This is possible because of the fact that amino acids are encoded by three nucleotides (codon) and some of the amino acids are encoded by more than one possible arrangement of nucleotides.