Protocol-msud-task5 protocol

From Bioinformatikpedia

HGMD

sequence used by HGMD can be found [here]

>gi|38372929|ref|NM_000709.2| Homo sapiens branched chain keto acid dehydrogenase E1, alpha polypeptide (BCKDHA), mRNA
GCCGGACCGCTGAGTGGTTGTTAGCCAAGATGGCGGTAGCGATCGCTGCAGCGAGGGTCTGGCGGCTAAA
CCGTGGTTTGAGCCAGGCTGCCCTCCTGCTGCTGCGGCAGCCTGGGGCTCGGGGACTGGCTAGATCTCAC
CCCCCCAGGCAGCAGCAGCAGTTTTCATCTCTGGATGACAAGCCCCAGTTCCCAGGGGCCTCGGCGGAGT
TTATAGATAAGTTGGAATTCATCCAGCCCAACGTCATCTCTGGAATCCCCATCTACCGCGTCATGGACCG
GCAAGGCCAGATCATCAACCCCAGCGAGGACCCCCACCTGCCGAAGGAGAAGGTGCTGAAGCTCTACAAG
AGCATGACACTGCTTAACACCATGGACCGCATCCTCTATGAGTCTCAGCGGCAGGGCCGGATCTCCTTCT
ACATGACCAACTATGGTGAGGAGGGCACGCACGTGGGGAGTGCCGCCGCCCTGGACAACACGGACCTGGT
GTTTGGCCAGTACCGGGAGGCAGGTGTGCTGATGTATCGGGACTACCCCCTGGAACTATTCATGGCCCAG
TGCTATGGCAACATCAGTGACTTGGGCAAGGGGCGCCAGATGCCTGTCCACTACGGCTGCAAGGAACGCC
ACTTCGTCACTATCTCCTCTCCACTGGCCACGCAGATCCCTCAGGCGGTGGGGGCGGCGTACGCAGCCAA
GCGGGCCAATGCCAACAGGGTCGTCATCTGTTACTTCGGCGAGGGGGCAGCCAGTGAGGGGGACGCCCAT
GCCGGCTTCAACTTCGCTGCCACACTTGAGTGCCCCATCATCTTCTTCTGCCGGAACAATGGCTACGCCA
TCTCCACGCCCACCTCTGAGCAGTATCGCGGCGATGGCATTGCAGCACGAGGCCCCGGGTATGGCATCAT
GTCAATCCGCGTGGATGGTAATGATGTGTTTGCCGTATACAACGCCACAAAGGAGGCCCGACGGCGGGCT
GTGGCAGAGAACCAGCCCTTCCTCATCGAGGCCATGACCTACAGGATCGGGCACCACAGCACCAGTGACG
ACAGTTCAGCGTACCGCTCGGTGGATGAGGTCAATTACTGGGATAAACAGGACCACCCCATCTCCCGGCT
GCGGCACTATCTGCTGAGCCAAGGCTGGTGGGATGAGGAGCAGGAGAAGGCCTGGAGGAAGCAGTCCCGC
AGGAAGGTGATGGAGGCCTTTGAGCAGGCCGAGCGGAAGCCCAAACCCAACCCCAACCTACTCTTCTCAG
ACGTGTATCAGGAGATGCCCGCCCAGCTCCGCAAGCAGCAGGAGTCTCTGGCCCGCCACCTGCAGACCTA
CGGGGAGCACTACCCACTGGATCACTTCGATAAGTGAGACCTGCTCAGCCCACCCCCACCCATCCTCAGC
TACCCCGAGAGGTAGCCCCACTCTAAGGGGAGCAGGGGGACCTGACAGCACACCACTGTCTTCCCCAGTC
AGCTCCCTCTAAAATACTCAGCGGCCAGGGCGGCTGCCACTCTTCACCCCTGCTCCTCCCGGCTGTTACA
TTGTCAGGGGACAGCATCTGCAGCAGTTGCTGAGGCTCCGTCAGCCCCCTCTTCACCTGTTGTTACAGTG
CCTTCTCCCAGGGGCTGGGTGAGGGCACATTCAGGACTAGAAGCCCCTCTGGGCATGGGGTGGACATGGC
AGGTCAGCCTGTGGAACTTGCGCAGGTGCGAGTGGCCAGCAGAGGTCACGAATAAACTGCATCTCTGCGC
CTGGCTCTCTACCAAAAAAAAAAAAAAAAAA

All Missense/Nonsense mutations listed in HGMD:

Q125E, T151M, D152N, R159W, Y166N, R167Q, Q190K, I213T, A216V, A220V, G249S, A253T, C258Y, C264W, R265W, N267S, G283D, A285P, 
R287TERM, G290R, R297C, R297H, G300S, D302A, T310R, R314TERM, I326T, E327K, A328T, R346H, R363W, F409C, V412M, Y413H, Y413C, Y438N,

dbSNP

rs Cluster Id Function AA Pos Codon Pos From Nucleotide To Nucleotide From AA To AA
rs17173144 synonymous 5 3 C T Ile [I] Ile [I]
rs34541442 synonymous 12 1 C A Arg [R] Arg [R]
rs146823708 missense 17 3 G C Leu [L] Phe [F]
rs140322984 synonymous 21 3 C T Ala [A] Ala [A]
rs111855817 missense 29 2 G A Gly [G] Glu [E]
rs62637712 synonymous 38 3 C G, T Pro [P] Pro [P], Pro [P]
rs34589432 missense 39 2 C A Pro [P] His [H]
rs80014754 synonymous 39 3 C A Pro [P] Pro [P]
rs150177278 missense 42 2 A G Gln [Q] Arg [R]
rs138373035 missense 59 2 C T Ala [A] Val [V]
rs149251798 missense 62 3 A G Ile [I] Met [M]
rs147370725 missense 71 2 A G Asn [N] Ser [S]
rs138025447 synonymous 71 3 C T Asn [N] Asn [N]
rs143167070 synonymous 80 3 C T Arg [R] Arg [R]
rs11549938 missense 82 1 A C Met [M] Leu [L]
rs147510183 missense 82 3 G A Met [M] Ile [I]
rs148571328 synonymous 96 3 C T His [H] His [H]
rs11549937 synonymous 97 3 G C Leu [L] Leu [L]
rs142967869 synonymous 98 3 G A Pro [P] Pro [P]
rs150700696 synonymous 112 3 T G Leu [L] Leu [L]
rs188135164 missense 117 1 C T Arg [R] Cys [C]
rs139678295 missense 127 1 C T Arg [R] Trp [W]
rs143608852 synonymous 140 3 G A Thr [T] Thr [T]
rs146804716 synonymous 141 3 C T His [H] His [H]
rs140612545 missense 150 1 A G Asn [N] Asp [D]
rs34442879 missense 151 2 C T Thr [T] Met [M]
rs34956071 missense 170 1 C T Pro [P] Ser [S]
rs190610188 missense 200 1 C T Arg [R] Cys [C]
rs144995574 synonymous 206 3 C T Ser [S] Ser [S]
rs10404506 synonymous 213 3 C T Ile [I] Ile [I]
rs114716391 synonymous 216 3 G T Ala [A] Ala [A]
rs151227241 synonymous 221 3 C T Tyr [Y] Tyr [Y]
rs141086188 missense 222 1 G A Ala [A] Thr [T]
rs146932786 synonymous 236 3 C T Phe [F] Phe [F]
rs28940288 missense 244 1 G A Gly [G] Arg [R]
rs137960127 synonymous 248 3 C T Ala [A] Ala [A]
rs61737367 synonymous 280 3 C T Arg [R] Arg [R]
rs145901144 missense 297 1 C T Arg [R] Cys [C]
rs187669174 synonymous 297 3 C T Arg [R] Arg [R]
rs138261404 missense 307 1 T C Tyr [Y] His [H]
rs139390622 synonymous 308 3 C T Asn [N] Asn [N]
rs144372407 missense 314 2 G A Arg [R] Gln [Q]
rs190858285 synonymous 316 3 G T Arg [R] Arg [R]
rs284652 synonymous 324 3 C T Phe [F] Phe [F]
rs112312448 frame shift 325 1 C None Leu [L] None
rs55940366 synonymous 325 3 C T Leu [L] Leu [L]
rs146300600 missense 344 2 C T Ala [A] Val [V]
rs182923857 missense 346 1 C T Arg [R] Cys [C]
rs139556493 missense 347 2 C T Ser [S] Leu [L]
rs144276456 synonymous 347 3 G A Ser [S] Ser [S]
rs185688419 missense 357 2 A G Gln [Q] Arg [R]
rs61736656 missense 361 1 A G Ile [I] Val [V]
rs190202447 synonymous 383 3 G A Arg [R] Arg [R]
rs139553536 missense 399 2 G A Arg [R] Gln [Q]
rs149722591 missense 403 2 C G Pro [P] Arg [R]
rs145595627 synonymous 403 3 C T Pro [P] Pro [P]
rs148090804 missense 404 2 A G Asn [N] Ser [S]
rs4674 synonymous 407 3 A C, G, T Leu [L] Leu [L], Leu [L], Leu [L]
rs147021347 synonymous 417 3 C T Pro [P] Pro [P]
rs34492894 synonymous 420 3 C T Leu [L] Leu [L]
rs141991700 missense 424 1 C A Gln [Q] Lys [K]
rs143065803 missense 429 2 G A Arg [R] His [H]
rs148224513 synonymous 443 3 C T Phe [F] Phe [F]

SNPdbe

Mutation Experimental evidence Disease Perc wt Perc mt
V3GNot validatedN/A690
L17FNot validatedN/A2922
L17FNot validatedN/A312
G29ENot validatedN/A340
G29ENot validatedN/A273
S36ANot validatedN/A369
P39HNot validatedN/A420
P39HNot validatedN/A400
Q42Rby freqN/A238
Q42Rby freqN/A2612
A59VNot validatedN/A3012
A59VNot validatedN/A329
I62Mby freqN/A89
I62Mby freqN/A78
N71Sby freqN/A1214
N71Sby freqN/A1213
M82INot validatedN/A108
M82LNot validatedN/A1060
M82INot validatedN/A118
M82LNot validatedN/A1059
R117C1000GenomeN/A60
R117C1000GenomeN/A60
R127WNot validatedN/A230
R127WNot validatedN/A211
N150Dby freqN/A48
N150Dby freqN/A48
T151M1000Genome,freq,clusterN/A70
T151M1000Genome,freq,clusterN/A70
Q157ANot validatedN/A511
Y158ANot validatedN/A66
R159WNot validatedmaple syrup urine disease type ia (SwissVar)650
R159ANot validatedN/A654
P170SNot validatedN/A2412
P170SNot validatedN/A2412
Q190KNot validatedmaple syrup urine disease type ia (SwissVar)195
R200C1000GenomeN/A61
R200C1000GenomeN/A61
S207ANot validatedN/A127
L209ANot validatedN/A66
T211ANot validatedN/A1319
T211MNot validatedN/A132
A222Tby freqN/A602
A222Tby freqN/A603
E238ANot validatedN/A88
G244RNot validatedN/A721
G244RNot validatedN/A712
A248DNot validatedN/A50
G249SNot validatedN/A1110
G249SNot validatedN/A1110
A253TNot validatedmaple syrup urine disease type ia (SwissVar)661
A253TNot validatedN/A701
A254DNot validatedN/A211
C264WNot validatedN/A114
C264WNot validatedN/A132
R265WNot validatedN/A63
R265WNot validatedN/A55
R265KNot validatedN/A55
R265ANot validatedN/A55
N267SNot validatedN/A623
Y269ANot validatedN/A213
A285PNot validatedN/A323
G289RNot validatedN/A251
G290RNot validatedmaple syrup urine disease type ia (SwissVar)221
R296CNot validatedN/A151
R297CNot validatedN/A172
Y306HNot validatedN/A127
Y307HNot validatedN/A126
T309RNot validatedN/A91
T310RNot validatedN/A81
R313QNot validatedN/A102
R314QNot validatedN/A102
I326TNot validatedmaple syrup urine disease type ia (SwissVar)264
H336ANot validatedN/A523
S337DNot validatedN/A273
A343VNot validatedN/A176
A344VNot validatedN/A167
R345C1000GenomeN/A160
S346LNot validatedN/A55
R346C1000GenomeN/A170
S347LNot validatedN/A55
W354FNot validatedN/A303
Q356R1000GenomeN/A718
Q357R1000GenomeN/A717
I360Vby cluster,freqN/A3210
I361Vby cluster,freqN/A3211
E397KNot validatedN/A2614
E398KNot validatedN/A2714
R398QNot validatedN/A66
R399QNot validatedN/A67
P402RNot validatedN/A531
P403RNot validatedN/A531
N403S1000GenomeN/A58
N404S1000GenomeN/A68
F408CNot validatedN/A401
F409CNot validatedmaple syrup urine disease type ia (SwissVar)411
Y413CNot validatedmaple syrup urine disease type ia (SwissVar)570
Q423KNot validatedN/A410
Q424KNot validatedN/A612
R428HNot validatedN/A132
R429HNot validatedN/A143
Y437NNot validatedN/A511
Y438NNot validatedmaple syrup urine disease type ia (SwissVar)531

OMIM

OMIM - BCKDHA
MutationPhenotype
Y393ASNMAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IA
deletion(8) 887-894MAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IA
G245RMAPLE SYRUP URINE DISEASE, INTERMEDIATE, TYPE IA
F364CMAPLE SYRUP URINE DISEASE, INTERMEDIATE, TYPE IA
R220WMAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IA
G204SMAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IA
T265RMAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IA
C219WMAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IA
deletion(1) 117CMAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IA

SNPedia

In SNPedia wie found the folowing four SNPs for MSUD.

  • rs12021720
  • rs17856511
  • rs28934895, also known as R183P (the most common SNP in Ashkenazi Jews); the risk genotype is CC
  • rs28940288

of those the first two are merged into one in dbSNP and do not concern the BCKDHA protein. The same goes for the third entry and the fourth is already contained in dbSNP.